We narrowed to 9,463 results for: Pol;
-
Plasmid#163957PurposeExression of ATI QconCAT protein in E. coli expression strains (BL21). Encodes a concatemer of tryptic peptides from wheat amylase/trypsin inhibitors. Used as standard for LC-MS-based quantification.DepositorInsertATI QconCAT
Tagspolyhistidine tagExpressionBacterialPromoterT7 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGS-CD64-2
Plasmid#109191PurposeEncodes full-length engineered CD64 with C-terminal Twin-Strep tag to be expressed in a baculovirus/insect cell expression systemDepositorInsertFull-length engineered CD64, derived from human CD64
TagsTwin-StrepExpressionInsectMutationengineered for efficient expression, see publicat…PromoterPolyhedrinAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac(His10-Shp2)
Plasmid#177899PurposeBaculo expression of His10 tag fused to human Shp2DepositorAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCOQ2
Plasmid#186025Purposeknock out COQ2 in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR4-Dact1(1250-1601)
Plasmid#52046PurposeTo generate mRNA in situ probe against mouse Dact1 (Probe C in PMID 17013874). For antisense cut with Spe1, transcribe with T7. For sense cut with Not1, treat with T4 polymerase, transcribe with T3.DepositorInsertDact1(1250-1601) (Dact1 Mouse)
ExpressionBacterialAvailable SinceApril 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
ArpC3-FLAG_pLib
Plasmid#173680PurposeArpC3 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorInsertArpC3 (ARPC3 Human)
TagsTEV cleavage site and FLAG tagExpressionInsectPromoterpolyhedrinAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PTBP1-RRM12CCtoSS
Plasmid#89155PurposeRecombinant expression of PTBP1-RRM12 C250S,C251S in E.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 1+2 mutant C250S, C251S (PTBP1 Human)
Tagshexa HisExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [2_n-1] (GB1206)
Plasmid#75407PurposetRNA and scaffold for the assembly of GBoligomers for the intermediate position (positon [2_n-1]) of a polycistronic tRNA-gRNA (3-part multiplexing)DepositorInserttRNA-gRNA position [2_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pfast bac cry1myc
Plasmid#51892PurposeBackbone plasmid is pfastBacHTa from invitrogenDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_2] (GB1205)
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pfast bac Rbx-HA
Plasmid#51893PurposeBackbone plasmid is pfastBacHTa from invitrogenDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN nls-BFP-FLAG-WPRE-bgh-pA (JDW 452)
Plasmid#229827PurposeA CAGGS driven nls BFP with a FLAG tag followed by a WPRE-bGH polyA for stable transcriptsDepositorInsert3xnls-TagBFP2-MCS-FLAG
ExpressionMammalianAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.T7-SP6-BC(p11-14)-CAG-EGFP-SV40pA-T7
Plasmid#231350PurposeSelf complementary AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-mDLX-minBG-CI-mRuby2-W3SL-T7
Plasmid#231352PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter with mDLX enhancer.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-minBG-CI-mRuby2-W3SL-T7
Plasmid#231353PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-tdTomato-W3SL-T7
Plasmid#231356PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses tdTomato from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CMVp-CI-mRuby2-W3SL-T7
Plasmid#231357PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from CMV promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-Ef1s-CI-mRuby2-W3SL-T7
Plasmid#231358PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from Ef1s promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-CI-mRuby2-W3SL-T7
Plasmid#231359PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CAG-EGFP-W3SL-T7
Plasmid#231348PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC177_CCR5(PGK-synEPOR)
Plasmid#232415PurposeAAV production plasmid for PGK(synEPOR) vector from Figs. 3-5 that mediates HDR at CCR5 locus using CCR5 gRNA. synEPOR is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8
Plasmid#224343PurposeExpresses human KDAC8 (HDAC8) in insect cellsDepositorAvailable SinceFeb. 26, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
p3E-WPRE-bGH-pA (JDW 1221)
Plasmid#224527PurposeA Gateway compatible 3' entry clone containing a WPRE upstream of Bovine growth hormone polyA to stabilize mRNDepositorInsertWPRE-bGH
UseGateway cloningAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6 H216A
Plasmid#224351PurposeExpresses human KDAC6 (HDAC6) H216A in insect cellsDepositorInsertKDAC6 (HDAC6 Human)
TagsTEV-cleavable His6ExpressionInsectMutationHistidine 216 mutated to alaninePromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastBacI-KDAC6 H611A
Plasmid#224352PurposeExpresses human KDAC6 (HDAC6) H611A in insect cellsDepositorInsertKDAC6 (HDAC6 Human)
TagsTEV-cleavable His6ExpressionInsectMutationHistidine 611 mutated to alaninePromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
p3E-IRES-H2A-mCherry-SV40-pA (JDW 1256)
Plasmid#224532PurposeA Gateway compatible 3' entry clone containing an IRES H2A mCherry followed by a polyADepositorInsertIRES-H2A-mCherry-SV40pA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only