We narrowed to 22,937 results for: cas9 genes
-
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
Tags3x FLAGExpressionMammalianPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev2
Plasmid#81207Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for1
Plasmid#81210Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-rev1
Plasmid#81208Purposefor targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGY18
Plasmid#221708PurposeEmpty Cas9 vector for multiplex gene editing in fungiDepositorTypeEmpty backboneUseCRISPR; AspergillusExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
1xNLS-pMJ915v2
Plasmid#88915PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertCas9
UseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only