We narrowed to 11,199 results for: AGA
-
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Synthetic, Human)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10-KS
Plasmid#237644PurposeFor overexpression of mEGFP-NUP98-DDX10-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-NGR-WPRE
Plasmid#234452PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-HA
Plasmid#141320PurposePlasmid to carry out IVT of RfxCas13d (human codon-optimized)DepositorInsertRfx-Cas13d
UseCRISPRTagsHAAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAMLD1
Plasmid#237675PurposeFor overexpression of mEGFP-YAP-MAMLD1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAML2
Plasmid#237674PurposeFor overexpression of mEGFP-YAP-MAML2DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-HOXA9
Plasmid#237639PurposeFor overexpression of mEGFP-NUP98-HOXA9DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-TAF1
Plasmid#65395PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE
Plasmid#234438PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorHas ServiceAAV1InsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-RfxCas13d-His
Plasmid#141322PurposePlasmid for bacterial expression and purification of RfxCas13d proteinDepositorInsertRfx-Cas13d
UseCRISPRTags6xHisExpressionBacterialPromoterT7Available SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV_ACE2-Flag_Hygro
Plasmid#191998PurposeLentiviral vector to generate flag-tagged ACE2 stable expressing cell lineDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_D770A-mCherry
Plasmid#192260PurposeExpresses PARP1 D770A mutant in mammalian cells. Tagged with mCherry.DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_R878A-mCherry
Plasmid#192261PurposeExpresses PARP1 R878A mutant in mammalian cells. Tagged with mCherry.DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-NLS-HA
Plasmid#141321PurposePlasmid to carry out IVT of RfxCas13d-NLS (human codon-optimized)DepositorInsertRfx-Cas13d (NLS-RfxCas13d-NLS)
UseCRISPRTagsHA and NLSAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRK5_mEGFP-TAZ-CAMTA1
Plasmid#237642PurposeFor overexpression of mEGFP-TAZ-CAMTA1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-NGR-WPRE
Plasmid#234451PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only