We narrowed to 21,776 results for: cas9 genes
-
Plasmid#65599Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-6
Plasmid#65593Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-5
Plasmid#65591Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-8
Plasmid#65596Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP56-7
Plasmid#65594Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APa13
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP54-3
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKI1.1R
Plasmid#85808PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter.DepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAG and NLSExpressionPlantPromoterAtRPS5AAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.0
Plasmid#86409PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter.DepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAG and NLSPromoterAtRPS5AAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Hygro
Plasmid#62205PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ173
Plasmid#98410PurposeCas9-gRNA lys9 plasmid for lys9 deletion in S. pombeDepositorInsertgRNA targeting Sp.lys9 (SPBC3B8.03 Fission Yeast)
UseCRISPRAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pBC2102-reci
Plasmid#117171PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLSDepositorInsertreci_wtCas9 without NLS
UseLentiviralPromoterU6 PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMK
Plasmid#62818PurposeBacterial constitutive S. pyogenes Cas9 expression plasmidDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
CRISPR-Sa-TdTom. Reporter
Plasmid#99652PurposeRed fluorescent reporter that can be activated by dSa Cas9 activator indicating activityDepositorInsertRFP
ExpressionMammalianMutationdead Cas9Available SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only