We narrowed to 70,185 results for: nin
-
Plasmid#109502PurposeMuscle specific zebrafish expression of mKate2 fused to 3xPHD domain from Mouse inhibitor of growth family member 2 (ING2), codon optimised. Binds PtdIns5PDepositorInsertactc1b-mKate2-ING2
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-XLF
Plasmid#207546PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XLF locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human Lig4 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEY51
Plasmid#191054Purposemec-3 fluorescent neural reporter driving nuclear CyOFP1 and mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGM35171
Plasmid#153222PurposeLevel 1 position 1 part containing the Nos promoter, the BAR gene, and the Ocs terminatorDepositorInsertNos promoter, BAR gene, Ocs terminator
UseSynthetic BiologyAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEY52
Plasmid#191055Purposeodr-1 fluorescent neural reporter driving nuclear mNeptune2.5 and mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-RNMT
Plasmid#112709PurposeExpresses N-terminally GST-tagged human RNMT in bacterial cellsDepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
p3E-APEX2-P2A-mKate2
Plasmid#67671PurposeMultisite gateway entry clone for adding C-terminal fusions of APEX2-P2A-mKate2DepositorInsertAPEX2-P2A-mKate2
UseGateway multisite 3' entry cloneAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-HISx6-SIMx6
Plasmid#116938PurposeBacterial expression vector for 6 simDepositorInsert6 sim
ExpressionBacterialPromoterT7Available SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-HISx6-SUMOx10
Plasmid#116937PurposeBacterial expression vector for 10 sumoDepositorInsert10 SUMO
TagsHISExpressionBacterialPromoterT7Available SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS1398
Plasmid#205971PurposeMWEE01000013 Cas5-HNH crRNA expression in pCOLADuet-1DepositorInsertCas5-HNH crRNA
ExpressionBacterialPromoterT7Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS1182
Plasmid#205964PurposeNZ_CP025815 DinG HNH crRNA expression in pCOLADuet-1DepositorInsertDinG HNH crRNA
ExpressionBacterialPromoterT7Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pME18ST-d5-HT7
Plasmid#53111PurposeExpression of Drosophila 5-HT7DepositorInsert5HT7 (5-HT7 Fly)
Available SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-CT3G-ERP2-MG-IRES2-mNeonGreen
Plasmid#175506PurposeAll-in-one piggyBac transposon destination vector for mCMV+dox-inducible expression of Mega Gate cloned elements upstream of IRES2-mNeonGreen (hEF1a-driven rtTA and puromycin resistance)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterTRE3G-mCMVAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
IA001: pMVP (L3-L2) 3x HA epitope tag+ polyA
Plasmid#121750PurposepMVP L3-L2 entry plasmid, contains 3x HA epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsert3x HA epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDE1084
Plasmid#168500Purposeexpression of T7RNA polymerase and CRISPR endonunclease Fncas12aDepositorInsertsFncas12a
T7RNA polymerase
UseCRISPRPromoterTDH3 and TEF1Available SinceDec. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
KX002: pMVP/PB-DEST
Plasmid#121869PurposepMVP destination vector, empty PiggyBac transposon vector backboneDepositorTypeEmpty backboneUsePiggybac transposon, pmvp gateway destination vec…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg1 hp
Plasmid#218093PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR H1-miR-30 L1-R5
Plasmid#62181PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a H1 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only