We narrowed to 25,343 results for: SPR
-
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only
-
EIF2AK1 gRNA (BRDN0001162524)
Plasmid#77050Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NLS-dCas13-NLS-eNAT10
Plasmid#238300PurposeExpresses nuclear version of the programmable RNA acetylation system.DepositorInsertdPspCas13b fused to eNAT10 (NAT10 Human, Prevotella sp. P5-125)
UseCRISPRTagsSV40 BPNLS and SV40 BPNLS (C terminal of dPspCas1…ExpressionMammalianMutationH133A for catalytically inactive mutant, deletion…Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001145887)
Plasmid#76392Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK9 gRNA (BRDN0001162576)
Plasmid#77170Purpose3rd generation lentiviral gRNA plasmid targeting human CDK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK9 gRNA (BRDN0001146478)
Plasmid#77169Purpose3rd generation lentiviral gRNA plasmid targeting human CDK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001146342)
Plasmid#75637Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146195)
Plasmid#76082Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146035)
Plasmid#76081Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001145294)
Plasmid#76083Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146875)
Plasmid#76084Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TetO-dCas9-D3A
Plasmid#78254PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) linked to IRES-mCherry under the control of TetOp and a minimal CMV promoterDepositorInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianPromoterCMVAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001146328)
Plasmid#77167Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147156)
Plasmid#75915Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147294)
Plasmid#75916Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E1B
Plasmid#64221PurposeExpression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry and to Ad4 E1B55K via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherry-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only