We narrowed to 7,126 results for: poly
-
Plasmid#71717PurposeMembrane scaffold protein (MSP), helix 4 to 6 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFE-Rs-FI-prk
Plasmid#162697PurposeExpresses R. spaeroides Form IC rubisco and S. elongatus PrkDepositorInsertR. spaeroides Form IC rubisco and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB
Plasmid#162699PurposeExpresses pHnCB10 derived carboxysome operon and prkDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4H5
Plasmid#71716PurposeMembrane scaffold protein (MSP), helix 4+ helix 5 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1delltaH4
Plasmid#71713PurposeMembrane scaffold protein (MSP), helix 4 deletionDepositorAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T_PV1_VP1
Plasmid#202071PurposeBacterial expression of VP1 protein from poliovirus 1 (PV1). Contains N-terminal GST-tag and C-terminal His6-tag.DepositorInsertPV1 VP1 protein with Histag
Tags6xHis-tag and GSTExpressionBacterialPromotertacAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-lambdaRED_NOC
Plasmid#127032PurposeBasic Part NOC- Complete ORF; LambdaRED / _RED; Policistronic "NOC" part with coding regions for the three lambda red proteins (the first; gam; doesn't have RBS; but bet and exo genes have RBS).DepositorInsertPart ?RED_NOC
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-26 (GB1001)
Plasmid#68208PurposeProvides the A. thaliana U6-26 RNA polIII promoter as a level 0 GoldenBraid partDepositorInsertAtU6-26 promoter
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUPD_OsU3 (GB1184)
Plasmid#68209PurposeProvides the O. sativa U3 RNA polIII promoter as a level 0 GoldenBraid partDepositorInsertOsU3 promoter
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Nectin-3 in situ probe
Plasmid#45633DepositorInsertNectin-3 in situ probe (Nectin3 Mouse)
UseIn situMutationfragment contains bp# 1626-2039 of NM_021495Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-HIPK2
Plasmid#179269PurposeExpresses GFP-LacI-HIPK2 fusion proteinDepositorInserthomeodomain interacting protein kinase 2 (HIPK2 Human)
TagsGFP-LacIExpressionMammalianPromoterCMVAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3B-3xFLAG
Plasmid#109214PurposeEncodes human full-length SIN3B with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_WT
Plasmid#162579PurposeExpresses norovirus GI.1 VP1 protein in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectPromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Fireworks GFP[PTC-] (AVA2598)
Plasmid#85445PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV5B+longBRD4
Plasmid#157792PurposeExpression of long isoform of BRD4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 Lysosomal-METRIQ
Plasmid#135401PurposeExpresses lysosomal-METRIQ (DNAse II-sfGFP together with cytosolic RFP) to measure lysosomal activityDepositorInsertDNAse II alpha (DNASE2 Human)
UseLentiviralTagsT2A, mCherry, and sfGFPExpressionMammalianMutationSingle-nucleotide polymorphism C432TAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-eIF3b
Plasmid#240025PurposeHuman eIF3b for further cloning or expression in insect cells for purificationDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only