We narrowed to 53,235 results for: PLE;
-
Plasmid#165890PurposePuromycin resistant GAL4 driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
8200 Bicistronic_GFP_ires_hygro
Plasmid#64375PurposeThis a retroviral expression plasmid expressing GFP along with hygro resistance geneDepositorInsertEGFP
UseRetroviralTagsEGFPAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Arp3_pLib
Plasmid#173677PurposeArp3 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE(K294A) NLS-Flag
Plasmid#82469PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzyme, inactive formDepositorInsertmRNA capping enzyme (Rngtt Mouse)
TagsFlag and MycExpressionMammalianMutationchanged Lysine 294 to AlaninePromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE NLS-Flag
Plasmid#82468PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzymeDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPK-351
Plasmid#157921PurposepcDNA-CMV-PIF3MTAD-IRES-PhyBGal4DBDDepositorInsertsPIF3-MTAD
IRES
PhyB(1-621)-SV40NLS-Gal4DBD
UseSynthetic Biology; OptogeneticsTagsHA tag and SV40NLSExpressionMammalianMutationpif3 1-523PromoterCMVAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt Mouse, HIV)
TagsmycExpressionMammalianMutationK294APromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-myc- mCE(Del 25C)
Plasmid#82472PurposeExpresses myc tag and mRNA capping enzyme without 25 amino acid from C-terminalDepositorAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMflPT-o4
Plasmid#101315PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and pac resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
pac resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMflST-o4
Plasmid#101316PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and aadA1 resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
aadA1 resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR04
Plasmid#69151Purposeread-outloxP mCherry to GFP switch, with eft-1::tagBFP::tbb-2UTR as gene of interest for integration on cxtTi10816, Mos Chr IVDepositorInsertsmCherry
TagBFP
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promotereef-1A.1 (eft-3) and rps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP*
Plasmid#175237PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the KmDepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-E2
Plasmid#175243PurposeBacterial expression and purification, E2 enzyme (UBC9) for SUMOylation, can be recruited to FRB with rapamycin, CyPet acts as a FRET donor to YpetDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP
Plasmid#175236PurposeBacterial expression and purification, high affinity SUMOylation substrate that can recruited to FRB with rapamycinDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-V9
Plasmid#173797PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene noctiflora ClpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V7
Plasmid#173796PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene latifolia clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V6
Plasmid#173795PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene conica clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V4
Plasmid#173794PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Nicotiana tabacum clpP1 gene with native regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
ExpressionBacterial and PlantAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits