We narrowed to 23,553 results for: c-myc
-
Plasmid#131162PurposeExpression of Septin rodsDepositorInsert6his-Cdc12 + Cdc11
UseBicistronicTagsCdc11: S-Tag and Cdc12: 6hisExpressionBacterialPromoterT7Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
CΔ2
Plasmid#74297PurposeMammalian expression of treacle (residues 1176-1270) fused to GFPDepositorInserttreacle ribosome biogenesis factor 1 (Tcof1 Mouse)
TagsGFPExpressionMammalianMutationExpresses residues 1176 - 1270PromoterCMVAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
CΔ3
Plasmid#74298PurposeMammalian expression of treacle (residues 1262-1302) fused to GFPDepositorInserttreacle ribosome biogenesis factor 1 (Tcof1 Mouse)
TagsGFPExpressionMammalianMutationExpresses residues 1262 - 1302PromoterCMVAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB24
Plasmid#61153PurposeExpression of Hnt1DepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
UIM-ECFP
Plasmid#21067DepositorAvailable SinceMay 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPS1597
Plasmid#8920DepositorAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
ABL1-HaloTag Fusion Vector
Plasmid#238634PurposeExpress ABL1-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertABL1 (ABL1 Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HaloTag-ABL1 Fusion Vector
Plasmid#238635PurposeExpress HaloTag-ABL1 Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertABL1 (ABL1 Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAM211 His-Ubp6
Plasmid#226359PurposeExpression of yeast Ubp6DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only