We narrowed to 25,670 results for: promoter
-
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)dTomato
Plasmid#200113PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence, no other pr…Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV
Plasmid#202004PurposeEmpty lenti backboneDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
-5.5kb-UCP1-GFP
Plasmid#104585PurposeReporter assay to monitor the transcription activity of the UCP1 promoter by GFP expressionDepositorAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas9
Plasmid#196325Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding SpCas9 in place of viral GPDepositorInsertFull length TSWV M antigenome encoding SpCas9 in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-ERT2-iCre-ERT2
Plasmid#178060PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under UBC promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGWB504
Plasmid#74846PurposeGateway cloning compatible binary vector for C-terminal fusion with sGFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC11
Plasmid#231659PurposeExpresses human ZDHHC11 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSP3-FR-2Strep
Plasmid#210315PurposeExpresses SARS-CoV-2 NSP3 in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-LgBiT-SpyCatcher
Plasmid#223634PurposeProtein purification of SpyCatcher003 (S49C) with LgBiT and 6xHis tags from E. coliDepositorInsertSpyCatcher003 S49C
TagsHis6, LgBiTExpressionBacterialAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHes7-Achilles-Hes7
Plasmid#153528PurposeExpresses fusion protein of Achilles/YFP and mouse Hes7 from mouse Hes7 promoter. The reporter shows oscillatory expression with 2-3 periodicity when expressed in mouse presomitic mesoderm.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS18 (mANGPTL3-Strep)
Plasmid#109111PurposeExpresses StrepII-tagged mouse ANGPTL3 in mammalian cellsDepositorAvailable SinceJune 5, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
ATP1A1_G6_T804N_Dual_pegRNA
Plasmid#173200PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGWB553
Plasmid#74883PurposeGateway cloning compatible binary vector for C-terminal fusion with mRFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only