We narrowed to 12,346 results for: pcDNA
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
(114) pcDNA3.1-GFP-Flag-JunB-EPEA
Plasmid#160743PurposeExpresses a GFP tagged JunB with Flag and EPEA tags.DepositorAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 C-term NPAT
Plasmid#187585PurposeExpress FLAG epitope and APEX2-tagged NPAT fusion protein in mammalian cellsDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-P2A-mCherry-PTS1
Plasmid#87803PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using P2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-kappa-myc-dL5-2xG4S-TMst
Plasmid#73206PurposeExpresses myc-dL5(E52D)-TM (PDGFR derived) on the surface of mammalian cells, with an Igk-leader. (MBIC5, dL5**, FAP)DepositorInsertkappa-myc-dL5-2XG4S-TM (MYC Human)
TagsThe FAP is fused with 2 copies of a G4S linker an…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term LMNA
Plasmid#187576PurposeExpress FLAG epitope and APEX2-tagged LMNA fusion protein in mammalian cellsDepositorAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term RNPS1
Plasmid#187574PurposeExpress FLAG epitope and APEX2-tagged RNPS1 fusion protein in mammalian cellsDepositorAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term SRSF1
Plasmid#187575PurposeExpress FLAG epitope and APEX2-tagged SRSF1 fusion protein in mammalian cellsDepositorAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Med24-exon minimal CMV pCDNA5
Plasmid#212060PurposeLR vector for integration of Med24-exon into N2a FRT rtTA3 expression cellsDepositorInsertMed24-exon (Med24 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Zmynd8+exon minimal CMV pCDNA5
Plasmid#212079PurposeLR vector for integration of Zmynd8+exon(48nt) into N2a FRT rtTA3 expression cellsDepositorInsertZmynd8+exon(48nt) (Zmynd8 Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-SREBP-1-GFP (A317-318; A341)
Plasmid#204198PurposeMammalian expression of SREBP-1 (isoform 1)DepositorInsertSREBP-1 (SREBF1 Human)
Tags3xHA, eGFP and T7x2ExpressionMammalianMutationGly to Ala 317,318,341Available SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term PSPC1
Plasmid#187579PurposeExpress FLAG epitope and APEX2-tagged PSPC1 fusion protein in mammalian cellsDepositorAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
1014 pcDNA3 T7 Akt1 K179M T308A S473A
Plasmid#9031DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-EF1A-mNeonGreen2x-SREBP1-P2A-Puro
Plasmid#228401PurposeEncodes a N-terminal truncated version of SREBP1 lacking part of the transcriptional activation domain and fused to a tandem of mNeongreen to visualize the import of SREBP1DepositorInsertSREBP1 (SREBF1 Human)
TagsmNeonGreen2xExpressionMammalianMutationdeleted N terminal activation domain (amino acids…PromoterEF1aAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 C-term SP100
Plasmid#187584PurposeExpress FLAG epitope and APEX2-tagged SP100 fusion protein in mammalian cellsDepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-COXIV-COX8-dL5-2XG4S-mCer3
Plasmid#73208PurposeExpresses dL5(E52D)-mCer3 fusion protein in mitochondria of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertCOXIV-COX8-dL5-2XG4S-mCer3 (COX8A Synthetic, Human)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 C-term SMN2
Plasmid#187587PurposeExpress FLAG epitope and APEX2-tagged SMN2 fusion protein in mammalian cellsDepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Carl-CeNL(Ca2+)_110μ-KDEL-pcDNA3
Plasmid#111925PurposeCyan color luminescent Ca2+ indicator targeted to endoplasmic reticulum. Calreticulin and a KDEL signal for ER retention located at the N-terminus and C-terminus of CeNL(Ca2+)_110μDepositorInsertCeNL(Ca2+)_110μ
TagsCalreticulin and KDELExpressionMammalianMutationE31D, F92W, E104D. D133E at CaMPromoterCMVAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only