We narrowed to 22,982 results for: cas9 genes
-
Plasmid#103098PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE0XXB7(Cas9 coding gene from uncultured delta proteobacterium HF0070_07E19)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E7H313
Plasmid#103104PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE7H313(Cas9 coding gene from Sutterella wadsworthensis 3_1_45B)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E9S7M7
Plasmid#103106PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE9S7M7(Cas9 coding gene from Ruminococcus albus 8)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-H1DEI0
Plasmid#103113PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertH1DEI0(Cas9 coding gene from Odoribacter laneus YIT 12061)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-I0X7Z6
Plasmid#103114PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertI0X7Z6(Cas9 coding gene from Treponema sp. JC4 GN=MSI_17100)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6KTN8
Plasmid#103076PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6KTN8(Cas9 coding gene from Actinomyces sp. oral taxon 180 str. F0310)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A1IQ68
Plasmid#103080PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA1IQ68(Cas9 coding gene from Neisseria meningitidis serogroup A / serotype 4A (strain Z2491))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A5EIM8
Plasmid#103081PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA5EIM8(Cas9 coding gene from Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A7HP89
Plasmid#103082PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA7HP89(Cas9 coding gene from Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B5JU35
Plasmid#103087PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB5JU35(Cas9 coding gene from gamma proteobacterium HTCC5015)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B5XLC1
Plasmid#103088PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB5XLC1(Cas9 coding gene from Streptococcus pyogenes serotype M49 (strain NZ131))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-C4ZA16
Plasmid#103090PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertC4ZA16(Cas9 coding gene from Eubacterium rectale (strain ATCC 33656 / VPI 0990))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only