We narrowed to 7,126 results for: poly
-
Plasmid#125167PurposeExpresses human PHF1 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only
-
KAT14-pDEST10
Plasmid#118382PurposeHIS-tagged insect cell expression vector with KAT14.DepositorAvailable SinceMay 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1 human full-length CENP-E-mNeon-6xHis
Plasmid#180484PurposepFastBac1 human CENP-E-mNeon-His, containing a 3c protease cleavage site between mNeon and His tag. Codon optimized for expression in Sf9 cellsDepositorInsertCENP-E (CENPE human, Synthetic, Human)
TagsmNeon-6xHisExpressionInsectPromoterpolyhedrin promoterAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-IRP2
Plasmid#226621PurposeExpresses human IRP2 in insect cellsDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MmEos3.2
Plasmid#203754PurposeEncodes the membrane anchor of Src including the first 15 resideues of the N terminus, with 1 myristoylation and short polybasic sequence, with mEos3.2 fused to the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF57/SMARCE1-His
Plasmid#177861PurposeTransfer vector to generate recombinant baculovirus expressing BAF57/SMARCE1-His proteinDepositorInsertSMARCE1 (SMARCE1 Human)
TagsHis tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N116C-G193C
Plasmid#162580PurposeExpresses norovirus GI.1 VP1 protein with mutations N116C-G193C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 116 was mutated to Cysteine and Glycin…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKE13-ISceI-fabp10a:CreERT2
Plasmid#198242PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter driving tamoxifen-inducible Cre recombinaseDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC6
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTYB11-PTBP1-RRM2CCtoSS
Plasmid#89154Purposerecombinant expression of PTBP1-RRM2 C250S,C251S in e.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 2 mutant C250S, C251S (PTBP1 Human)
TagsIntein and chitin binding domainExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q62C-A140C
Plasmid#162581PurposeExpresses norovirus GI.1 VP1 protein with mutations Q62C-A140C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 62 changed to Cysteine and Alanine 140 …PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET26b(+)-ATI_QconCAT_1
Plasmid#163957PurposeExression of ATI QconCAT protein in E. coli expression strains (BL21). Encodes a concatemer of tryptic peptides from wheat amylase/trypsin inhibitors. Used as standard for LC-MS-based quantification.DepositorInsertATI QconCAT
Tagspolyhistidine tagExpressionBacterialPromoterT7 promoterAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGS-CD64-2
Plasmid#109191PurposeEncodes full-length engineered CD64 with C-terminal Twin-Strep tag to be expressed in a baculovirus/insect cell expression systemDepositorInsertFull-length engineered CD64, derived from human CD64
TagsTwin-StrepExpressionInsectMutationengineered for efficient expression, see publicat…PromoterPolyhedrinAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCOQ2
Plasmid#186025Purposeknock out COQ2 in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac(His10-Shp2)
Plasmid#177899PurposeBaculo expression of His10 tag fused to human Shp2DepositorAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only