We narrowed to 15,311 results for: EGF;
-
Plasmid#233042PurposeTo Express a GFP human Tau E14 fusion protein from a CMV promoterDepositorAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pICOZ-MAG[EF1α-CD19 4-1BB-eGFP]
Plasmid#218344PurposeDonor plasmid of MAG Transposon with CD19 CAR mammalian expression cassetteDepositorInsertCD19 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-rDA2m-IRES-EGFP-CAAX
Plasmid#208694PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_rDA2m and a membrane-localized EGFP in mammalian cellsDepositorInsertGPCR activation based dopamine (DA) sensor GRAB_rDA2m
ExpressionMammalianPromoterCMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV UBC APEX2-3xFLAG-IRES-eGFP
Plasmid#214983PurposeCytosolic APEX2 control. Can be used as a C-terminal APEX2 fusion by digestion with NheI and Gibson cloning (see comments).DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2-UAS-zArchon1-KGC-EGFP-ER2
Plasmid#108427PurposeCodon-optimized Archon1 fluorescent voltage reporter in zebrafish expression plasmidDepositorInsertzArchon1-KGC-EGFP-ER2
UseZebrafishPromoterUASAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-Rheb(S16H)-IRES-eGFP-W
Plasmid#32520DepositorInsertConstitutively active Rheb (S16H) (Rheb Rat)
UseLentiviralExpressionMammalianMutationS16H to make constitutively activePromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
WT1-2A-eGFP PGK PuroR Donor Plasmid
Plasmid#82333PurposeWT1 targeting donorDepositorUseCRISPR and TALENTags2A-eGFPExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-AppNL-G-F-P2A-EGFP
Plasmid#242648PurposeFloxed (DIO) AAV transgene designed to be packaged in AAV and to express the amyloid precursor protein (App) with familial mutations AppNL-G-F in a Cre-recombinase dependent manner.DepositorInsertFloxed (DOI) AAV transgene with human synapsin promoter driving amyloid precursor protein with familial mutations and EGFP tag
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFPExpressionMammalianPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-P2A-EGFP
Plasmid#188898PurposeHuman lentiviral vector for expression of dCas9 with a C-terminal HA-2xNLS and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9
UseLentiviralTagsHA-2xNLS and P2A-GFPPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-MinE(L4E)-EGFP_IRES-Blast
Plasmid#213117PurposeExpression of a faster-running MinE mutant in mammalian cellsDepositorInsertMinE(L4E)-EGFP (minE Escherichia coli)
UseLentiviralExpressionMammalianMutationL4EPromoterEF1aAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCAG eGFP T2A SP HALO HAPLN1
Plasmid#228200PurposeAAV vector expressing GFP and HaloTag-HAPLN1 under constitutive promoterDepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)
Plasmid#139992PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRQR=D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-mPGK-eGFP (beta-globin intron)
Plasmid#162513PurposeAAV vector plasmid expressing enhanced green fluorescent protein (eGFP) under the mouse phosphoglycerate kinase (mPGK) promoter that is upstream of a beta-globin intronDepositorInserteGFP
UseAAVExpressionMammalianPromotermPGKAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1A-Puro-hTBK1-E696K-EGFP
Plasmid#221554PurposeExpresses GFP-tagged human TBK1 with E696K mutation in mammalian cells. Compatible with piggybac transposase for genome integration.DepositorInsertTBK1 (TBK1 Human)
UsePiggybacTagsGFPExpressionMammalianMutationChanged glutamate 696 to lysinePromoterEF1aAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV:eGFP-p2A-HA-β2Ar-uTEV1Δ(220-242)
Plasmid#135459PurposeMammalian expression of SPARK protease componentDepositorInserteGFP-p2A-HA-βarrestin2-uTEV1Δ
UseLentiviralTagseGFP, HAExpressionMammalianPromoterCMVAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 762 (pCS2-EGFP-hsKRAS4B-G12V)
Plasmid#156407PurposepCS2 CMV expression vector driving EGFP fused human KRAS4B-G12VDepositorInserthuman mutant KRAS4B-G12V (KRAS Human)
TagsEGFPExpressionMammalianMutationmutant KRAS4B-G12VPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GSDMD-eGFP-SV40p-BlasR
Plasmid#228254PurposepLenti-CMV-GSDMD-eGFP-SV40p-BlasR plasmid for ectopic expression of human full-length GSDMD fusion with GFPDepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
KL157 - pBlueScript II SK-Grb10_HA-T2A-eGFP-SV40PolyA
Plasmid#232935PurposeDonor plasmid for knock-in of T2A-eGFP-SV40pA at the mouse Grb10 locus. Used with PX459-sgRNA048_Grb10 sgRNA.DepositorInsertT2A-eGFP-SV40pA with Grb10 homology arms
UseMouse TargetingAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only