We narrowed to 49,708 results for: lat
-
Plasmid#46239PurposeFLAG-HA-CAD with S1859 phosphorylation site mutated to alanineDepositorInsertcarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad Mouse)
TagsFLAG and HAExpressionMammalianMutationSerine 1859 changed to Alanine (S1859A)PromotercmvAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-AtRBX1-T7-AtSKP1-T7-AtCUL1-S
Plasmid#238003PurposeExpression AtRBX1-T7, AtSKP1-T7 and AtCUL1-S in in bacterial cellsDepositorTagsS and T7ExpressionBacterialAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303/7A
Plasmid#118365PurposeThis plasmid expresses human HSF1 S303A and S307A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GalNAc-T2-GFP-ESCargo(FTV)
Plasmid#140163PurposeExpresses a regulatable secretory cargo for mammalian cells and a Golgi markerDepositorInsertGalNAc-T2-msGFP2 and piGH-FTVNTT-DsRed-Express2-FKBP(LV)(C22V) (GALNT2 Human, Synthetic)
TagsER signal sequence (MGWSCIILFLVATATGAHS) (N termi…ExpressionMammalianPromoterEF-1aAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF-Bos TRAM Flag
Plasmid#41551DepositorAvailable SinceDec. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-AR-S256A
Plasmid#171227PurposeMammalian expression of un-tagged human androgen receptor phosphorylation mutant: AR-Ser256Ala (AR-S256A)DepositorInserthuman androgen receptor Ser256Ala mutant (AR Human)
ExpressionBacterial and MammalianMutationAR-Ser256Ala (AR-S256A)PromoterCMVAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-AR-S308A
Plasmid#171229PurposeMammalian expression of un-tagged human androgen receptor phosphorylation mutant: AR-Ser308Ala (AR-S308A)DepositorInserthuman androgen receptor Ser308Ala mutant (AR Human)
ExpressionBacterial and MammalianMutationAR-Ser308Ala (AR-S308A)PromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-AR-S90A
Plasmid#171225PurposeMammalian expression of un-tagged human androgen receptor phosphorylation mutant: AR-Ser90Ala (AR-S90A)DepositorInserthuman androgen receptor Ser90Ala mutant (AR Human)
ExpressionBacterial and MammalianMutationAR-Ser90Ala (AR-S90A)PromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-MUTED
Plasmid#164629PurposeExpresses MUTED in mammalian cells with a GFP tagDepositorAvailable SinceJune 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF019 MBP-β-catenin-His
Plasmid#154070PurposeExpresses MBP-β-catenin-His (human β-catenin as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgCIC-2
Plasmid#74959PurposeCas9 + sgCIC-2 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgCIC-1
Plasmid#74953PurposeCas9 + sgCIC-1 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMVA2
Plasmid#119951PurposeExpresses recombinant MVA pathway in Escherichia coliDepositorInsertsmvaE
mvaS
mvaK1
mvaK2
mvaD
idi
ExpressionBacterialMutationA110GAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV5-B
Plasmid#74978PurposeshETV5 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.5 shETV5-A
Plasmid#74977PurposeshETV5 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NMHC-IIA-3xA
Plasmid#101041PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying S1943A mutation and S1916A, S1915A mutation, driven by CMV promoter. Thus inhibits CKII and PKC phosphorylation of the tail.DepositorInsertNon-muscle myosin IIA heavy chain (MYH9 Human)
TagsGFPExpressionMammalianMutationS1915A, S1916A, S1943APromoterCMVAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF073 MBP-Axin-His
Plasmid#154011PurposeExpresses MBP-Axin-His (human Axin as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-T2A-mCherry-PTS1
Plasmid#87827PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using T2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only