We narrowed to 14,480 results for: SHR;
-
Plasmid#119245Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJG363
Plasmid#91183PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A single nickase (nAtCas9_D10A+gNt_R2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_zeo
Plasmid#184910PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCi-hTRAC-sgRNA
Plasmid#154093PurposepQCi backbone with sgRNA targeting human TCR-alpha common chainDepositorInsertsgRNA targeting human TRAC locus
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT2_1
Plasmid#106308PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hNEUROD1 gRNA_1-MS2-Puro
Plasmid#192676PurposeLentiviral expression of sgRNA targeting hNEUROD1 promoter to activate human NEUROD1 transcriptionDepositorInsertHuman NEUROD1 activating gRNA #1 (NEUROD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_GAL4UAS-Luciferase reporter
Plasmid#64157PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA1 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA1 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJMP1290
Plasmid#119267Purposeconstruction intermediateDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pV1464
Plasmid#111440PurposeN. castellii Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6-miR-30 L1-R5
Plasmid#62113PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_D
Plasmid#72623PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCVpic2blast-EGFP-FF2
Plasmid#164923PurposeExpresses EGFP cDNA and FF2 shRNA in mammalian cellsDepositorInsertsUseRetroviralAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISP_IS
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-UAG site)
Plasmid#170138PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcriptDepositorInsertBoxB-RAB7A(UAG)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-ACG site)
Plasmid#170155PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcript for C-U editingDepositorInsertBoxB-RAB7A(ACG)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3020(gRNA X-2)
Plasmid#73282PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only