We narrowed to 12,286 results for: shRNA
-
Plasmid#186890PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO SF-HERC2 (ShB-R)
Plasmid#55613PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged wild-type HERC2 in Flp-In TREx cellsDepositorInsert3xFLAG tagged HERC2 (WT) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationSilent mutations have been incorporated into the …Available SinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSPCas9(BB)-2A-GFP_ABCA3GFP_targeting
Plasmid#188541PurposePlasmid encoding pCas9 and gRNA targeting the endogenous human ABCA3 locus stop codonDepositorInsertgRNA
UseCRISPRTagsGFPPromoterU6Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-STING_gRNA3
Plasmid#127640PurposeKnock-out of human STINGDepositorInsertSTING (STING1 Human)
UseLentiviralAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148862)
Plasmid#80263Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146750)
Plasmid#77280Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146095)
Plasmid#77278Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_Rosa_sgRNA
Plasmid#97007PurposeExpresses Cas9 and Rosa26 locus specific sgRNADepositorInsertRosa26 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
RfxCas13d-backbone
Plasmid#165078PurposeExpression of RfxCas13d sgRNAs from a U6 promoterDepositorInsertScaffold gRNA
ExpressionMammalianAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #2
Plasmid#136585PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgFSP1
Plasmid#186026Purposeknock out FSP1 in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14901
Plasmid#239276PurposeExpresses gG1 for pertubing endogenous human GAPDH mRNA via CRISPR-TODepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only