We narrowed to 18,240 results for: CAG
-
Plasmid#108733PurposeExpresses N-terminus to aa251 of Cre recombinase fused to FRB CIDDepositorInsertCre recombinase fragment N-terminus to aa251
UseCre/Lox and Synthetic BiologyTagsFRB,NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2608_pCAG-PV1-FKBP-L1-iCre-252C-NLS-BGHpA
Plasmid#108734PurposeExpresses aa252 to C-terminus of Cre recombinase fused to FKBP CIDDepositorInsertCre recombinase fragment aa252 to C-terminus
UseCre/Lox and Synthetic BiologyTagsFKBP and NLSExpressionMammalianPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW758_pCAG-PV1-VloxP-FRT-lox2272-NeoR-BGHpA
Plasmid#87580PurposePV1 for 3-input, 2-output Full AdderDepositorInsertNeomycin Resistance Gene
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable sinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 TNRC6A
Plasmid#20021DepositorInsertTrinucleotide repeat containing 6A (TNRC6A Human)
UseGateway CloningAvailable sinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman AMPK alpha 2 exon1 gRNA (PRKAA2 Human)
UseCRISPRPromoterU6Available sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMU-LEr
Plasmid#61185PurposeFluorescent reporter for late endosome mCherry-MtRAB5A2 expressed under AtUBQ10 promoterDepositorInsertMtRAB5A2
TagsmCherryExpressionPlantPromoterAtUBQ10Available sinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable sinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pERB221
Plasmid#61502Purposeconst. CenpB-GFP-Halo + mCherry-DHFRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCenpB-GFP-Halo
mCherry-DHFR
TagsHaloTag and mCherryExpressionMammalianAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SV40 basal promoter-LacZ
Plasmid#18816DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSV40 basal promoter-LacZ
ExpressionMammalianAvailable sinceJuly 27, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9
Plasmid#184464PurposePlasmid encoding PRDM9-Cas9 fusion under CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable sinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
nLuc-GLP-1R-His-FLAG
Plasmid#124831PurposeExpresses N-terminally NanoLuc-Tagged GLP-1R in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGLP1R (GLP1R Human, Synthetic)
UseLuciferaseTagsFLAG, His6, and NanoLucExpressionMammalianPromoterCMVAvailable sinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato targeting vector (compatible with CAGGS-AsCpf1-2A-GFP-U6-AAVS1-sgRNA)
Plasmid#194728PurposeAAVS1-tdTomato targeting vector, compartible with Cpf1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttdTomato
UseCRISPR; Knockin targeting plasmidAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-Myc-GFP-Vpr-RR
Plasmid#83374PurposeExpression of Myc tagged GFP-Vpr fusion proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMyc-GFP-Vpr
TagsMyc and Myc-GFPExpressionMammalianPromoterCMVAvailable sinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV6)
Viral prep#37825-AAV6PurposeReady-to-use AAV6 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-PIK3C2B
Plasmid#161989PurposeMammalian expression vector containing PIK3C2B tagged with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPIK3C2B (PIK3C2B Human)
TagsGFPExpressionMammalianMutationsiRNA resistance to siRNA#2 with 4 silent mutatio…Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
G10 Cas9 MDC123
Plasmid#59187PurposeG10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoterG10Available sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
K9L mutant of H3K9me3 biosensor
Plasmid#120807PurposeFRET biosensor. Eliminating the H3 lysine 9 methylation site in H3K9me3 biosensor to abolish the detection capabilityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
ExpressionMammalianMutationlysine 9 is mutated to leucine 9 on histone H3PromoterCMVAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 3782
Plasmid#31979DepositorAvailable sinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only