We narrowed to 16,681 results for: GRN
-
Plasmid#78542PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.2
Plasmid#78537PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDG462
Plasmid#100903PurposeSpCas9n (D10A Nickase mutant) with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pDG461
Plasmid#100902PurposeSpCas9n (D10A Nickase mutant) with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-EGFPExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pNA0304
Plasmid#165612PurposeVector for expression of sgRNAs in yeast: SNR52p-NotI-sgRNA-SUP4t (NotI site in place of the spacer)DepositorInsertSNR52p-NotI-sgRNA-SUP4t (S. cerevisiae SNR52 promoter driving the sgRNA for SpCas9, with a NotI site in place of the spacer)
UseCRISPRExpressionYeastMutationNotI site replaced the CAN1 spacer in parent vect…PromoterSNR52Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLV-U6-UL29-egfp-U3-UL8
Plasmid#166694PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (EGFP version).DepositorAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_hph
Plasmid#184915PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_hph recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only