We narrowed to 166,390 results for: addgene
-
Plasmid#141150PurposeFluorescent labeling of the outer mitochondrial membrane (OMM) in mammalian cellsDepositorInsertOMP25 (Synj2bp Rat)
TagsAcGFPExpressionMammalianMutationOMP25 c terminus from addgene plasmid #69598PromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
p300dAIL KAT LIC 1M
Plasmid#233588PurposeBacterial expression of p300 KAT enzyme with truncated autoinhibitory loopDepositorInsertp300dAIL KAT (EP300 Human)
Tags6xHis MBPExpressionBacterialMutationdeleted amino acids 1523-1554PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenSyn2-EGFP-OMP25C
Plasmid#71427PurposeLentiviral expression of EGFP-OMP25C. For visualization of neuronal mitochondria.DepositorInsertOMP25 (172-‐206) (Synj2bp Rat)
UseLentiviralTagsEGFPExpressionMammalianMutationaa 172-206 onlyPromotersynapsinAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_HA1mut
Plasmid#190475PurposeExpress the histamine-insensitive control sensor GRAB_HA1mut in neuronsDepositorInsertHistamine-insensitive sensor GRAB_HA1mut (control sensor)
UseAAVPromoterhSynAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNA-CasRx_SD1-pSV40-TagBFP
Plasmid#221004PurposeTransiently express CasRx DR30 repeat with gRNA spacer. Contains SD1 mutation to enhance efficiency. SV40-TagBFP cassette to monitor transfection efficiency. Use BbsI with overhangs Fw-AAAC, Rv-AAAA.DepositorInsertCasRx 30nt processed direct repeat with SD1 mutation
UseCRISPRExpressionMammalianMutationDR1 A>TPromoterU6Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-moxGFP
Plasmid#227273PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-moxGFP cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMVtight-UPRT-T2A-RFP-IRES-CD
Plasmid#126677PurposeDoxycycline inducible expression of UPRT and CD along with reporter RFPDepositorInsertUPRT-T2A-RFP-IRES-CD (FCY1 Budding Yeast, Toxoplasma gondii)
Promotertight TREAvailable SinceJune 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasTet-λ
Plasmid#128318PurposeConstitutive expression of cas9 and anhydrotetracycline/tetracycline inducible expression of lamda RED. Useful variant of Plasmid #62225 when arabinose induction is not possible.DepositorInsertTetR and pTetR/TetO
UseCRISPR and Synthetic BiologyExpressionBacterialMutationConstitutive expression of cas9 and anhydro-tetra…Promotertet promoterAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
HIS-HA-CMYC P53
Plasmid#233738Purposeexpresses HIS-HA-CMYC triple tagged P53 for pulldown assayDepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ
Plasmid#64875Purposelentiviral expression of human POLQDepositorAvailable SinceAug. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
plRL117
Plasmid#163635PurposeOptimized M. smegmatis CRISPRi plasmid; L5 integrating.DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterTet-OnAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-GRAB_ATP1.0
Plasmid#167579PurposeExpress the ATP sensor GRAB_ATP1.0 in astrocytesDepositorAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
sUPRa
Plasmid#223242PurposesUPRa is a dual promoter and two-color construct, which is designed to report the global unfolded protein response (UPR) and affords unbiased cell detection irrespective of UPR levelsDepositorInsertsUPRa
UseAAVPromoterCustomAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGM
Plasmid#71250Purposeluciferase reporter with human GM-CSF promoter -627 to + 28DepositorInsertGM-CSF promoter -627 to +28 fragment (CSF2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSFAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS3_pCSdest
Plasmid#53839DepositorAvailable SinceMarch 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti_PEmax-2A-MLH1dn-2A-BSD
Plasmid#234072PurposeFor lentiviral expression of PEmax with MLH1dn and blasticidin resistanceDepositorInsertPEmax-2A-MLH1dn
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only