We narrowed to 7,126 results for: poly
-
Plasmid#160562PurposetRNA and scaffold for the assembly of GBoligomers for the third position (positon [D3_4]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInserttRNA-gRNA position E3 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KS
Plasmid#136617PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SNF5
Plasmid#109186PurposePlasmid for expression of C-terminally 3xFLAG-tagged SNF5 under the control of a polh promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-INPP5E
Plasmid#236004PurposeLysosome-targeted inositol polyphosphate 5 phosphatase (INPP5E); hydrolyzes 5-phosphate in PI(3,4,5)P3 and PI(4,5)P2.DepositorTagsFull-length LAMP1 and mCherryExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC177_CCR5(PGK-synEPOR)
Plasmid#232415PurposeAAV production plasmid for PGK(synEPOR) vector from Figs. 3-5 that mediates HDR at CCR5 locus using CCR5 gRNA. synEPOR is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC89_CCR5(UbC-tEPOR-2A-YFP)
Plasmid#232404PurposeAAV production plasmid for UbC-tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at CCR5 locus using CCR5-sg3 gRNA. YFP is followed by a BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304-EZH1-Y727F
Plasmid#203582PurposeExpresses V5-tagged mutant version of EZH1 partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationchanged Tyrosine 727 to Phenylalanine for partial…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-EZH1-dPSET
Plasmid#203586PurposeExpresses V5-tagged mutant version of EZH1 with deletion of aa 744-747 and partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationdeletion of aa 744-747 and partial resistance to …PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-EZH1-D745N
Plasmid#203585PurposeExpresses V5-tagged mutant version of EZH1 partially resistant to JQ-EZ-05 in mammalian cells.DepositorInsertEZH1 (EZH1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationchanged Aspartic Acid 745 to Asparagine for parti…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTW5126
Plasmid#129732Purposepolyhistidine replacement of EatA passenger DUF corresponding to amino acids E541 -Q617 of the native EatA proteinDepositorInserteatA-DUF::His8
Tags9His tagExpressionBacterialMutationreplaces the domain of unknown function correspon…PromoteraraBADAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169162PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp10 in insect cellsDepositorInsertnsp10-6His-3xFlag (ORF1ab Synthetic, SARS-CoV-2)
Tags6His-3xFlagExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp14 (SARS-CoV-2)
Plasmid#169163PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp14 in insect cellsDepositorInsert3xFlag-6His-nsp14 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shGLS
Plasmid#110335PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene, puromycin selectionDepositorInsertGLS glutaminase (GLS Synthetic, Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Antibody#218106-rAbPurposeAnti-DYKDDDDK (Flag) tag chimeric recombinant antibody with fused mouse variable and rabbit constant domains; binds in a calcium-dependent manner to the N-terminal DYKDDDDK sequence.DepositorRecommended ApplicationsWestern BlotReactivitySyntheticSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#203885-rAbPurposeAnti-Glutamate carboxypeptidase 2 (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceNov. 8, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pZ M2rtTA_CAGG TetON-Sox10 with GFP
Plasmid#115241PurposeRMCE donor vector for inducible expression of SOX10 and GFP and constitutive expression of m2rtTA (generated from plasmid #112668)DepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -