We narrowed to 7,219 results for: Gaa
-
Plasmid#136137PurposeL1 in position 2, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB2797
Plasmid#63639PurposepCfB2797 is a vector for multiple integrations at sites sharing homology with Ty2Cons. The selective marker is Kl.URA3. Additionally it contains a USER cassette.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoternoneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2793
Plasmid#64043PurposepCfB2793 is a vector for multiple integrations at sites sharing homology with Ty2Cons. The selective marker is Kl.URA3. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoter and noneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2800
Plasmid#63657PurposepCfB2800 is a vector for multiple integrations at sites sharing homology with Ty2Cons. The selective marker is Kl.LEU2. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2875
Plasmid#63640PurposepCfB2875 is a vector for multiple integrations at sites sharing homology with Ty3Cons. The selective marker is Kl.URA3. Additionally it contains a USER cassette.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoternoneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2989
Plasmid#63636PurposepCfB2989 is a vector for multiple integrations at sites sharing homology with Ty1Cons1. The selective marker is Kl.URA3. Additionally it contains a USER cassette.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoternoneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRE2-Bla(HA–RILP-FLAG)
Plasmid#102424PurposeDual tagged RILP for expression in mammalian cells.DepositorInsertRab interacting lysosomal protein (RILP Human)
TagsFLAG and HAExpressionMammalianPromoterTet-ResponsiveAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shMYB.2572
Plasmid#105574PurposeDox-inducible mir30 MYB shRNA/dsRED expression with Venus marker and neo resistanceDepositorInsertMYB shRNA #2572
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB2795
Plasmid#63650PurposepCfB2795 is a vector for multiple integrations at sites sharing homology with Ty1Cons1. The selective marker is Kl.URA3. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL12009
Plasmid#68257PurposeLevel 0 Golden Gate Part: Promoter and 5UTR Ubiquitin (Zea mays)DepositorInsertPromoter and 5UTR Ubiquitin (Zea mays)
UseSynthetic BiologyAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB2988
Plasmid#63638PurposepCfB2988 is a vector for multiple integrations at sites sharing homology with Ty1Cons2. The selective marker is Kl.URA3. Additionally it contains a USER cassette.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoternoneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pCfB2796
Plasmid#63641PurposepCfB2796 is a vector for multiple integrations at sites sharing homology with Ty4Cons. The selective marker is Kl.URA3. Additionally it contains a USER cassette.DepositorTypeEmpty backboneUseCre/LoxExpressionYeastPromoternoneAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE2-Bla(HA–RILP)
Plasmid#102425PurposeHA tag fused to the N-terminus of RILP for the expression in mammalian cells.DepositorInsertRab interacting lysosomal protein (RILP Human)
TagsHAExpressionMammalianPromoterTet-responsiveAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB2794
Plasmid#63651PurposepCfB2794 is a vector for multiple integrations at sites sharing homology with Ty1Cons2. The selective marker is Kl.URA3. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2798
Plasmid#63659PurposepCfB2798 is a vector for multiple integrations at sites sharing homology with Ty4Cons. The selective marker is Kl.LEU2. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCfB2791
Plasmid#63654PurposepCfB2791 is a vector for multiple integrations at sites sharing homology with Ty4Cons. The selective marker is Kl.URA3. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro human lipin 1-1 shRNA
Plasmid#32019DepositorInsertlipin1 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shREN
Plasmid#105586PurposeDox-inducible mir30 shREN (control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB2792
Plasmid#63653PurposepCfB2792 is a vector for multiple integrations at sites sharing homology with Ty3Cons. The selective marker is Kl.URA3. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-Zfp423
Plasmid#35972DepositorAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
LEP-shREN
Plasmid#105580Purposeretrovirally express control shRNA with puro resistance and GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only