We narrowed to 19,678 results for: cat
-
Plasmid#199105PurposeLevel 2 plasmid, barcoded ORI with gentamicin resistance cassette and mScarlet-I reporterDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpBBR1-UP ORI plus NGS barcode 21, gentamicin resistance cassette, mScarlet-I cassette, oriT
UseSynthetic BiologyAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-bc339
Plasmid#190848PurposeFor mammalian expression of bc339, the RNA aptamer of β-catenin. Expression is driven by a U6 promoter.DepositorInsertbc339 (an RNA aptamer of β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available sinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M7NS_AmpR
Plasmid#119157PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
UseCrisprPromoterJ23119Available sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-Y-GECO1
Plasmid#55767PurposeExpress Y-GECO1 in neuronsDepositorPublicationInsertY-GECO1.0
UseAAVExpressionMammalianPromoterhSynAvailable sinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
PHB1
Plasmid#212153PurposeFor PHB production in E. coli (PT7-pMB1).DepositorInsertpoly(3-hydroxyalkanoate) polymerase subunit PhaC, PHA-specific beta-ketothiolase, acetoacetyl-CoA reductase
ExpressionBacterialPromoterPT7Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR2_ccA
Plasmid#158114Purposedeletion hADAR2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertADAR2 (ADARB1 Human)
ExpressionMammalianAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-PPHLN1 ts2
Plasmid#115878PurposePPHLN1 knockdownDepositorAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-VASP-5
Plasmid#55513PurposeLocalization: Actin/Focal Adhesions, Excitation: 462, Emission: 492DepositorInsertVASP
TagsmTFP1ExpressionMammalianMutationA209T in VASPPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-ZO1-C-14
Plasmid#55518PurposeLocalization: Tight Junctions, Excitation: 462, Emission: 492DepositorAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL1
Plasmid#48741PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to -141 with respect to transcription start site at +1)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttruncated mPer2 promoter/enhancer region (-1128 to -141)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available sinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV_tKiMBI-T2A-caMEK
Plasmid#199578PurposeExpresses tKiMBI and caMEK in an AAV vectorDepositorPublicationInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator
constitutively active MEK
UseAAVExpressionMammalianPromoterCMVAvailable sinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AaCas12b(D977A)-2AeGFP
Plasmid#121962PurposeMammalian expression, Transcription regulation, deactivated AaCas12bDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCatalytically deactivated AaCas12b
Tags3xHA tagExpressionMammalianMutationD977AAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-H3.3-N-14
Plasmid#55490PurposeLocalization: Nucleus/Histones, Excitation: 462, Emission: 492DepositorAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CC-FLAG
Plasmid#179162PurposeExpression vector of human protein phosphatase 3, catalytic subunit, gamma isoform (PPP3CC) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertprotein phosphatase 3, catalytic subunit, gamma isoform (PPP3CC Human)
TagsFLAGExpressionMammalianAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only