168,499 results
-
Plasmid#91757PurposeBacterial expression of a fluorescent protein, Blue Fluorescent Protein (BFP)DepositorInsertBlue Fluorescent Protein
TagsHexa-Histidine, Xpress epitope for detection with…ExpressionBacterialMutationGFP (Y66H)PromoterT7Available SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sybody Generation Toolbox
Plasmid Kit#1000000160PurposeThe Seeger Lab protocol to select synthetic nanobodies – called sybodies – against (membrane) protein targets. This collection contains all plasmids necessary for the sybody generation.DepositorAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC5
Plasmid#231654PurposeExpresses human ZDHHC5 proteinDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNCA
Plasmid#17363DepositorInsertMMLV proviral DNA
Available SinceMarch 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti Lifeact-EGFP BlastR
Plasmid#84383PurposeLentiviral expression of EGFP-tagged Lifeact with Blasticidin selection in cells including neuronsDepositorInsertLifeact
UseLentiviralTagsEGFPPromoterCMV immediate earlyAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF2932
Plasmid#144408PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-FLAG PHGDH
Plasmid#212995Purposeexpresses human PHGDHDepositorAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV.CamKII.GCaMP6s.WPRE.SV40
Plasmid#107790PurposeAAV expression of ultrasensitive protein calcium sensor from the CamKII promoterDepositorHas ServiceAAV9InsertGCaMP6s
UseAAVExpressionMammalianPromoterCamKIIAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hs.NRAS Q61R
Plasmid#83179PurposeGateway ORF Entry clone of human NRAS [NM_002524.4 ] with stop codon (for native or N-terminal fusions), Q61R mutationDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
6x-His_A1aY1_GFP
Plasmid#158753PurposeBacterial expression of 6xHis-A1aY1 fused with carboxy terminus GFP for recombinant purificationDepositorInsert6xHistidine_A1aY1_GFP
Tags6x-Histidine tag, GFP, T7 leader sequence, and Th…ExpressionBacterialPromoterT7Available SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
ITPR1_Halo_N_allele
Plasmid#178161PurposeDonor vector for endogenous tagging of human ITPR1 at the N-terminus with halotagInsertHalotag (ITPR1 Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-Calr-KDEL-IRES-Puromycin
Plasmid#134664PurposeExpresses EGFP-tagged endoplasmic reticulum markerDepositorInsertcalreticulin (CALR Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdeleted amino acids 18-413PromoterEF1aAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorInsertgRNA target sequence for luciferase control
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pfwB
Plasmid#37329DepositorInsertGFP
ExpressionMammalianPromoterEF1aAvailable SinceJuly 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag Jnk3a1
Plasmid#13758DepositorAvailable SinceFeb. 22, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-RMA-IRES-EGFP
Plasmid#189629PurposeExpresses Gluc-RMA and EGFP under the hSyn promoter. Gluc-RMA for monitoring neuronal transduction.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICH47742::2x35S-5’UTR-hCas9(STOP)-NOST
Plasmid#49771PurposeLevel 1 hCas9 moduleDepositorInsert35Sp::hCas9
UseCRISPRAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
FR_HNF4A8
Plasmid#31114DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-FLAG-hSF3B1-K700E
Plasmid#82577PurposeExpresses a codon-optimized ORF of human SF3B1 ( K700E mutant)DepositorInserthuman SF3B1-K700E (SF3B1 Human)
TagsFLAG peptideExpressionMammalianMutationK700EPromoterCMVAvailable SinceMarch 6, 2017AvailabilityAcademic Institutions and Nonprofits only