We narrowed to 25,285 results for: crispr
-
Plasmid#107588PurposepCLV3:Cas9DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterArabidopsis CLAVATA3Available sinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pLenti_PEmax-2A-MLH1dn-2A-BSD
Plasmid#234072PurposeFor lentiviral expression of PEmax with MLH1dn and blasticidin resistanceDepositorInsertPEmax-2A-MLH1dn
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7_CC_PEmax_IVT_Template
Plasmid#216793PurposeTemplate for in vitro transcription of PEmax.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPEmax
ExpressionMammalianPromoterT7Available sinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-Cre-2A-mScarlet
Plasmid#207745PurposeExpression of the Cre recombinase linked to a mScarlet fluorescent markerDepositorInsertCre-PGK-mScarlet
UseCre/LoxExpressionMammalianPromoterEF1alphaAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
BCJJ125
Plasmid#117515PurposeCas9_3 (with intron) Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_3(intron):GCTT:BsaI
UseCRISPRTags2xFLAG and NLSExpressionPlantAvailable sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVEGFR1_TEV(C)_TCS(Q'G)_NLS-HA-dCas9(C)-VP64_T2A_MCP-P65-HSF1
Plasmid#101103PurposeEncodes dCas9(C)-VP64 with SAM components fused to VEGFR1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVEGFR1-dCas9(C)
UseCRISPR and Synthetic BiologyTagsHAExpressionMammalianAvailable sinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136-tRNA2.0
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-array1
Plasmid#140623PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-array1. The crRNA-array1 targets 8 different loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-array1
UseCRISPR; TransposonExpressionBacterialAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pQCascade-IS1
Plasmid#140624PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS1. The crRNA-IS1 targets IS1 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS1
UseCRISPR; TransposonExpressionBacterialAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTFAP2C (TFAP2C Human)
UseCRISPRExpressionMammalianAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSPDEF.1.0-gDNA
Plasmid#113796PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SPDEFDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSPDEF (SPDEF Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF423.1.0-gDNA
Plasmid#113790PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF423DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertZNF423 (ZNF423 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertZFX (ZFX Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNFXL1.1.0-gDNA
Plasmid#112451PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NFXL1DepositorAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTEAD1.1.0-gDNA
Plasmid#112425PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TEAD1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTEAD1 (TEAD1 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pERF.1.0-gDNA
Plasmid#112395PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ERFDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertERF (ERF Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-AsiA
Plasmid#158063PurposeExpressing CasTA of dCas9 fused AsiADepositorInsertdCas9-AsiA
ExpressionBacterialPromoterTetOAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
FISSEQ-hgRNA-Design2
Plasmid#100572PurposeFISSEQ-hgRNA-Design2 in a lentiviral backboneDepositorInsertFISSEQ-hgRNA-Design2
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFZ1035
Plasmid#246938PurposeGmWUS along with RUBY for soybean genome editingDepositorInsertGmWUS, Cas9, RUBY
UseCRISPRExpressionPlantPromoterNOS, AtUbi10Available sinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only