We narrowed to 13,411 results for: BASE
-
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-L1L2
Plasmid#114017PurposeCreate Entry clones for Gateway LR reactions through simple restriction enzyme based cloningDepositorInsertccdB gene, Chloramphenicol resistance gene
UseGateway CloningAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
dClover2-CytERM-N-17
Plasmid#56308PurposeLocalization: Endoplasmic Reticulum, Excitation: 505, Emission: 515. This plasmid encodes dClover2 A206K, H231L based on publication.DepositorInsertCytERM
TagsdClover2ExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-synmiR-L-mRuby-Pro-EGFR-mEGFP-4×18
Plasmid#218266PurposeExpresses EGFR-mEGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-EGFR-mEGFP-MREL_4×18
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113698PurposeDox-inducible U6 SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
mouse pGL3-ank3_1-promoter firefly luciferase
Plasmid#86436PurposeMouse pGL3-ank3_1-promoter firefly luciferase, ca 2000 base pairs around TSS exon 1eDepositorInsertank3_1 promoter
Tagsn/aExpressionMammalianMutationn/aPromoterankyrin-3_1Available SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDB24-XhoI_D40
Plasmid#254737PurposeDesign 40DepositorInsertDesign 40
TagsHIS and SUMOExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDB24-XhoI_bmTyr*
Plasmid#254740PurposebmTyr* (bmTYR R209H mut)DepositorInsertbmTyr*
TagsHIS and SUMOExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDB24-XhoI_NF
Plasmid#254741PurposeNaive FusionDepositorInsertNaive Fusion
TagsHIS and SUMOExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDB24-XhoI_D7
Plasmid#252872PurposeDesign 7DepositorInsertDesign 7
TagsHIS and SUMOExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDB24-XhoI_D42
Plasmid#254738PurposeDesign 42DepositorInsertDesign 42
TagsHIS and SUMOExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Rit-APP12-YA3-HC
Plasmid#254750PurposeRituximab HC N299QDepositorInsertRituximab HC
ExpressionMammalianMutationChanged Asparagine 299 to GlutamineAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only