We narrowed to 1,648 results for: CAG promoter
-
Plasmid#59360PurposeLentiviral expression vector: p53 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI H2B-GFP
Plasmid#92399PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-EGFP reporter.DepositorInsertIRES H2B EGFP
ExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAT007
Plasmid#171634PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-TRAC
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKC-Tol2
Plasmid#85600PurposeSource of Tol2 transposase driven by a mini-CAGS promoter.DepositorInsertTol2 transposase
ExpressionMammalianPromotermini-CAGAvailable SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAX-SCLM
Plasmid#216757PurposeFor strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoterDepositorInsertSuperClomeleon
ExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCAG (cytomegalovirus-chicken beta-actin-rabbit be…Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKTol2C-EGFP
Plasmid#85598PurposeTol2 transposon with EGFP driven by minimal-CAGs promoter.DepositorInsertTol2 transposon with EGFP
ExpressionMammalianPromotermini-CAGAvailable SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn2
Plasmid#59358PurposeLentiviral expression vector: Neuroligin 2 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB
Plasmid#247329PurposeVector encoding human codon-optimized engineered DelIscB driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdx1-mTQ2-P2A-FlpO-PA
Plasmid#67279PurposePancreas specific expression of the FlpO recombinase controlled by the pdx1 promoter . FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertsmTQ2=mturquoise2 blue fluorescent gene
FlpO recombinase
Tagslinked to FlpO through an P2A ribosomal skipping …ExpressionMammalianPromoterpdxAvailable SinceJuly 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB-T5E
Plasmid#247330PurposeVector encoding human codon-optimized engineered DelIscB fused with T5E at C-terminal driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB-T5E_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFAP-MCS-WPRE-SV40 - GCH31
Plasmid#230829PurposeAAV cloning vector for expression under the GFAP promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-MCS-WPRE-SV40 - GCH13
Plasmid#230820PurposeAAV cloning vector for expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only