We narrowed to 9,379 results for: mel
-
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorArticleInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PURO
Plasmid#52419PurposeConstitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette.DepositorInsertERAS (ERAS Human)
PromoterCAGGSAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-mgp100-PuroR [M1G]
Plasmid#171802PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20 MEF2C S222A
Plasmid#89718PurposeLentiviral gene expression vector for doxycycline inducible MEF2C-S222A expressionDepositorInsertMEF2C (MEF2C Human)
UseLentiviralExpressionMammalianMutationChanged serine 222 to alanineAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M4/X184PG-IRES(isoform 2)
Plasmid#99568Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M3/Y92C-IRES(isoform 2)
Plasmid#99567Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 2)
Plasmid#99566Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 2)
Plasmid#99565Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreenDepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-Tomato MEF2C S222A
Plasmid#89716PurposeRetroviral gene expression vector for MEF2C-S222A expressionDepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES_Tomato MEF2C S222D
Plasmid#107231PurposehMEF2C phosphomimetic obtained from Quikchange Lightning MutagenesisDepositorAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M2/X184W-IRES(isoform 1)
Plasmid#99560Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-M1/R141L-IRES(isoform 1)
Plasmid#99559Purposemammalian expression of mutant TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-MitoDREADD-Gs
Plasmid#247960PurposeCre dependant viral expression of HA-MitoDREADD-GsDepositorInsertMitoDREADD-Gs
UseAAVTags4x COX8 mitochondrial leading sequence, HAPromoterCAGAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-DREADD-Gs
Plasmid#247957Purposeexpresses HA-DREADD-GsDepositorInsertDREADD-Gs
TagsHAExpressionMammalianPromoterCMVAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-DREADD-Gs
Plasmid#247959PurposeCre dependant viral expression of HA-DREADD-GsDepositorInsertDREADD-Gs
UseAAVTagsHAAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MitoDREADD-Gs
Plasmid#247958Purposeexpresses HA-MitoDREADD-GsDepositorInsertMitoDREADD-Gs
Tags4x COX8 mitochondrial leading sequence, HAExpressionMammalianPromoterCMVAvailable SinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pROM-POU3F2p-mCherry-Neo
Plasmid#153321PurposeExpresses mCherry from the POU3F2 promoterDepositorAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only