We narrowed to 10,151 results for: tre promoter
-
Plasmid#120497PurposeBarcoded lentiviral vector to express KLF11 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pGL3-FLIP pr4
Plasmid#19129DepositorInsertFLIP promoter (CFLAR Human)
UseLuciferaseExpressionMammalianMutationThe sequence corresponds to positions -503 to +10…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_ERalpha(Y537S)-P2A-Hygro_Barcode
Plasmid#170225PurposeBarcoded lentiviral vector to express ERalpha (Y537S) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCh2007_pLenti_Syn_mChe-cdc42E7
Plasmid#118620Purposeexpression of mChe-tagged cdc42E7 under pSyn promoter for primary neuronsDepositorInsertcdc42E7 (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged cagtctg to ggcataa (667 - 673 nt in 3…Promotersynapsin I (rat)Available SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ATOH7-T2A-PuroR
Plasmid#162343PurposeLentiviral expression of ATOH7 under the control of the TetON promoterDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-158/+19
Plasmid#35541DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3-110/+19
Plasmid#35542DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMTgR2
Plasmid#107286PurposePlasmid can be used for Drosophila S2 driven secretion of extracellular part of human interferon-_ receptor 2.DepositorInsertInterferon gamma receptor 2 (IFNGR2 Human)
TagsCATCATCACCATCACCATGAExpressionInsectPromoterMetallothionein promoterAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-64/+19
Plasmid#35543DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceAug. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKlab813-bGlobin_3xF-BRCA1(full-length)-Y1845D
Plasmid#249024PurposeThis plasmid expresses the full length BRCA1 sequence (Y1845D mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab814-bGlobin_3xF-BRCA1(full-length)-M1775R
Plasmid#249025PurposeThis plasmid expresses the full length BRCA1 sequence (M1775R mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationM1775RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab816-bGlobin_3xF-BRCA1(full-length)-G1788V
Plasmid#249026PurposeThis plasmid expresses the full length BRCA1 sequence (G1788V mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationG1788VPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab818-bGlobin_3xF-BRCA1(full-length)-A1708E
Plasmid#249027PurposeThis plasmid expresses the full length BRCA1 sequence (A1708E mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationA1708EPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab819-bGlobin_3xF-BRCA1(full-length)-Y1845F
Plasmid#249028PurposeThis plasmid expresses the full length BRCA1 sequence (Y1845F mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845FPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab525-pcDNA3-3xFLAG-V5-BRCA1(1314-end)-WT-STOP
Plasmid#249008PurposeThis plasmid expresses the N-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab187-pcDNA3-BRCA1(1314-end)-WT-V5-3xFLAG
Plasmid#249013PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mTDGa.2-BioID2-HA
Plasmid#232029Purposemammalian expression (CMV promoter) of TDGa.2 (SIM mutant E321Q) fused to BioID2-HADepositorInsertTdg (Tdg Mouse)
TagsBioID2-HAExpressionMammalianMutationK341A (site directed mutagenesis: aag -> aag)PromoterCMVAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst1-3xHA
Plasmid#183540PurposeExpress Dcst1-3xHA under the mouse Clgn promoter.DepositorAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Std_Dual_epegRNA_tevopreQ1
Plasmid#187457PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only