We narrowed to 20,133 results for: epo
-
Plasmid#114427PurposeTarget a Cre-dependent GFP and a tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tTA2
UseCre/Lox and Mouse TargetingExpressionMammalianPromoterPGK, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai133 (TITL-ssAPEX2tm) targeting vector
Plasmid#114432PurposeTarget a Cre-dependent electron microscopy tag ssAPEX2tm cassette into the mouse TIGRE locusDepositorInsertssAPEX2tm
UseCre/Lox and Mouse TargetingPromoterTREtightAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai161 (TIT2L-GFP-ICR-tTA2) targeting vector
Plasmid#114429PurposeTarget a Cre-dependent GFP cassette and Dre-dependent tTA2 cassette to the mouse TIGRE locusDepositorInsertGFP
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd E255A -Cas9n-UGI-NLS
Plasmid#109429PurposeExpresses the C-terminal catalytically inactive mutant of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal Doman E255A Catalytic Mutant (APOBEC3B Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115893PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-Utr28-222
Plasmid#231558PurposeExpresses N- and C-terminally truncated Utrophin calponin homology domain fused to C-terminally truncated msfGFP for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertUtrophin calponin homology domain (UTRN Human)
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetON-Sox10
Plasmid#115242PurposeLentiviral plasmid for tet-inducible expression of Sox10 (generated from plasmid #20321)DepositorInsertSOX10 (SOX10 Human)
UseLentiviralAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10 with GFP
Plasmid#115241PurposeRMCE donor vector for inducible expression of SOX10 and GFP and constitutive expression of m2rtTA (generated from plasmid #112668)DepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ P (cHS4)X4 TetON-3XFLAG-tdT CAGG-m2rtTA v2
Plasmid#112669PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows inducible expression and contains cHS4 insulators.DepositorInserttdT
UseAAV; Donor plasmid for recombinase-mediated casse…ExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-(negative selection module)-Chimeric_BB-CBh-hSpCas9
Plasmid#223321PurposeIt contains a ccdB-CMr negative selection module flanked by BpiI (BbsI) sites that allows excluding clones without correct insertion of sgRNA. Human codon optimized Cas9 expressing plasmid.DepositorInsertsUseCRISPR and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-45: TTN-mEGFP
Plasmid#114412PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TTN, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertTTN Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (TTN Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector
Plasmid#114433PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6s, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Calb1-T2A-dgCre targeting vector
Plasmid#114438PurposeTarget dgCre into the endogenous mouse Calb1 locus at the stop codonDepositorInsertdgCre
UseMouse TargetingTagsDHFR domain and EGFPPromoternone; utilizes endogenous Calb1 promoter for expr…Available SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
Plasmid#114428PurposeTarget a Cre-dependent GCaMP6f expression and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6f
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc beta-actinh7TAA-msfGFPΔN7ΔC11-SSSSactin
Plasmid#231549PurposeMammalian expression of human β-actin fused intramolecularly to N- and C-terminally truncated monomeric sfGFP, for actin filament organization measurements using fluorescence polarizationDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only