We narrowed to 1,553 results for: grna cloning vector
-
Plasmid#32704DepositorInsertemGFP-miRNA
UseCre/Lox, RNAi, and RetroviralExpressionMammalianAvailable SinceDec. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUDP003
Plasmid#101164PurposeE. coli/S. cerevisiae amdS shuttle vector allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT076
Plasmid#137880PurposeDonor vector for integration at the human AAVS1 safe harbor locus of Doxicycline-inducible dCas9-VPR-T2A-EGFPDepositorInsertTRE3G-dCas9-VPR-T2A-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT077
Plasmid#137879PurposeDonor vector for integration into the human AAVS1 safe harbor locus of Doxicycline-inducible KRAB-dCas9-IRES-EGFPDepositorInsertTRE3G-KRAB-dCas9-IRES-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGC31
Plasmid#19678DepositorInsertGateway(R1-R2)-L4440
UseRNAi; Gateway destination vectorAvailable SinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGMV-U
Plasmid#112797PurposeUniversal BeYDV-derived vector for cloning of up to four gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGC49
Plasmid#19680DepositorInsertGateway(R1-R2)-L4440
UseRNAi; Gateway destination vectorAvailable SinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGC48
Plasmid#19679DepositorInsertGateway(R2-R1)-L4440
UseRNAi; Gateway destination vectorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEF1aAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMCL9
Plasmid#176186Purpose2 mu cloning vector for single or multiplexed gRNAs, SNR52p-sfGFP-scRNA-SUP4t-CYC1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
shNTC
Plasmid#73549PurposeNon-targeting control shRNA cloned in retroviral vector pMLP (MSCV-based vector expressing shRNA in a mir30 context).DepositorInsertshNTC
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Kpn1
Plasmid#203297PurposeFor expression of sgRNAs in a PlayBack Vector with Kpn1 as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Xba1
Plasmid#203300PurposeFor expression of sgRNAs in a PlayBack Vector with XbaI as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlayBack-U6-Bamh1
Plasmid#203298PurposeFor expression of sgRNAs in a PlayBack Vector with Bamh1 as a PlayBack Restriction EnzymeDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only