We narrowed to 15,186 results for: egf
-
Plasmid#258788PurposeP2A-EGFP fusionDepositorInsertP2A-EGFP
ExpressionMammalianPromoterEndogenousAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIVT-desNb_EGFP-BleoR-mRuby2
Plasmid#252240PurposeTemplate for IVTR of destabilized antibody against EGFP or EBFP with PuroR-mRuby2 as effectorDepositorInsertT7-desNb-EGFP-BleoR-mRuby2
UseSynthetic BiologyExpressionMammalianMutationN/APromoterT7Available sinceJuly 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 SNAT2-eGFP 3NQ
Plasmid#237232PurposeDonor vector for gateway cloning of sgRNA-resistant SNAT2 (SLC38A2) cDNA sequence containing C-terminal eGFP. SNAT2 sequence contains mutations to inhibit N-linked glycosylation.DepositorInsertSLC38A2 (SLC38A2 Human)
TagseGFPExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…Available sinceJuly 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 SNAT2-eGFP WT (wildtype)
Plasmid#237228PurposeLentiviral vector expressing dox-inducible sgRNA-resistant wildtype SNAT2 (SLC38A2) cDNA containing C-terminal eGFP.DepositorInsertSLC38A2 (SLC38A2 Human)
UseLentiviralTagseGFPExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…PromoterTREAvailable sinceJuly 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 SNAT2-eGFP 3NQ
Plasmid#237229PurposeLentiviral vector expressing dox-inducible sgRNA-resistant SNAT2 (SLC38A2) cDNA containing C-terminal eGFP. SNAT2 sequence contains mutations to inhibit N-linked glycosylation.DepositorInsertSLC38A2 (SLC38A2 Human)
UseLentiviralTagseGFPExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…PromoterTREAvailable sinceJuly 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 SNAT2-eGFP WT (wildtype)
Plasmid#237231PurposeDonor vector for gateway cloning of sgRNA-resistant wildtype SNAT2 (SLC38A2) cDNA sequence containing C-terminal eGFP.DepositorInsertSLC38A2 (SLC38A2 Human)
TagseGFPExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…Available sinceJuly 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
eGFP-MKRN2-dRING-pcDNA4/TO
Plasmid#257246PurposeExpresses eGFP-MKRN2 with mutated RING domain under tetracycline inducible promoter. All cysteine and histidine residues in the RING domain were mutated to alanine.DepositorAvailable sinceJune 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_internal PA-TubA1A-IRES-EGFP
Plasmid#255804Purposemammalian expression of PA-tagged human TubA1A(E254A). The PA tag (GVAMPGAEDDVV) is inserted between Ile42 and Gly43 in the flexible loop of TubA1A. An IRES drives expression of EGFP reporter.DepositorAvailable sinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Gfa2-VIVIT-EGFP
Plasmid#254430PurposeFor production of AAV containing VIVT-EGFPDepositorInsertVIVIT-Green Fluorescent Protein
UseAAVPromoterGfa2Available sinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-hEAG1-Variant 2
Plasmid#253764PurposePlasmid for expression of the wildtype human EAG1/KCNH1, isoform 2 with an IRES-EGFP serving as reporter.DepositorAvailable sinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-hEAG1-Variant 1
Plasmid#253763PurposePlasmid for expression of the wildtype human EAG1/KCNH1, isoform 1 with an IRES-EGFP serving as reporter.DepositorAvailable sinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
tetOFF-EGFP^PTC-231
Plasmid#254991PurposeExpress doxycycline-repressive EGFP^PTC-231 in mammalian cellsDepositorInsertEGFP^PTC-231
ExpressionMammalianMutationNAAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e(∆HNH)-EGFP
Plasmid#251974PurposeMitochondrial ABE with HNH truncatedDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastMutationHNH deletedPromoterGPDAvailable sinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTS-ABE8e(∆REC2)-EGFP
Plasmid#251975PurposeMitochondrial ABE with REC2 truncatedDepositorInsertABE8e
UseCRISPRTagsMTS and V5-P2A-EGFPExpressionYeastMutationREC2 deletedPromoterGPDAvailable sinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R168X (pc4748)
Plasmid#248577PurposeMammalian expression plasmid of MeCP2-R168X (aa1- aa167)DepositorAvailable sinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R255X (pc4749)
Plasmid#248578PurposeMammalian expression plasmid of MeCP2-R255X (aa1- aa254)DepositorAvailable sinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TRE3GS-eGFP
Plasmid#252871PurposeTRE3GS expression plasmid for Flp/FRT recombination expressing eGFPDepositorInserteGFP
ExpressionMammalianPromoterTRE3GSAvailable sinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
FRB-mUSH1C-DFCR-pEGFP
Plasmid#251431PurposeMammalian expression vector for expressing the actin-binding motif of mouse harmonin b with an N-terminal FRB and a C-terminal EGFPDepositorInsertThe DFCR fragment (residues 296-728 of Ush1C) (Ush1c Mouse)
TagsEGFP and FRBExpressionMammalianAvailable sinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-EGFP-PURO
Plasmid#251732PurposeOverexpression construct expressing EGFP-PURO and ORF-BCDepositorInsertEGFP
UseLentiviralAvailable sinceMarch 2, 2026AvailabilityAcademic Institutions and Nonprofits only