We narrowed to 18,351 results for: multi
-
Plasmid#173873PurposeMammalian expression of mCherry-NES-SspB-SOS2cat-P2A-iLIDcaax (opto-Ras)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-NES-SspB-SOS2cat-P2A-iLIDcaax
TagsC-terminal CAAX-box and mCherryExpressionMammalianPromoterCMVAvailable sinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEcRNAP6
Plasmid#128940PurposepET21a derivative encoding E. coli core RNA polymerase subunits: RpoA, B, C-ppx(His)10, ZDepositorInsertsTagsHisExpressionBacterialMutationPreScission protease site (GE Healthcare; LEVLFQG…PromoterT7Available sinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Anti-Mortalin/GRP75 [N52A/42.1R]
Plasmid#114548PurposeMammalian Expression Plasmid of anti-Mortalin/GRP75 (Mouse). Derived from hybridoma N52A/42.1.DepositorInsertanti-Mortalin/GRP75 (Mus musculus) recombinant mouse monoclonal antibody (Hspa9 Mouse)
ExpressionMammalianPromoterdual CMVAvailable sinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJC-repo1.9kb-TALE4-VP64-P10
Plasmid#104612PurposeExpresses TALE4 under the control of a 1.9kb repo enhancer elementDepositorAvailable sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN
Plasmid#99049PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domainDepositorInsertsExpressionYeastAvailable sinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTE4495
Plasmid#80338Purposemammalian expression MbCpf1 nuclease and Mb crRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsMb crRNA
MbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC-SUR-YR
Plasmid#61768PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing sulfonylurea resistance gene (ILV alelle from Magnaporthe oyrzae) on transfer DNA (TDNA).DepositorInsertsSur gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromoterMagnaporthe oryzae ILV promoterAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGB_YFP-MiniTurboID
Plasmid#222433PurposeGolden Gate / Green Gate module for adding YFP and MiniTurboID as N-terminus of target protein.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDiCre-mCherry
Plasmid#164572PurposeIntegration of a DiCre cassette in PbGFP parasite genomeDepositorInsertsFKBP12-CRE59
FRB-CRE60
mCherry
Bifunctional dihydrofolate reductase-thymidylate synthase (TGME49_249180 Toxoplasma gondii)
UseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-Nav1 Na+ channel [N419/40R]
Plasmid#114552PurposeMammalian Expression Plasmid of anti-Pan-Nav1 Na+ channel (Human). Derived from hybridoma N419/40.DepositorInsertanti-Pan-Nav1 Na+ channel (Homo sapiens) recombinant mouse monoclonal antibody (SCN5A Mouse)
ExpressionMammalianPromoterdual CMVAvailable sinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-Hif1a(776-826) + CBP TAZ1(340-439)
Plasmid#99343PurposeBacterial expression of mouse CBP TAZ1 domain as coexpression with Hif1a TADDepositorAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-WIP 460 deletion
Plasmid#11773DepositorInsertWIP aa1-460 (WIPF1 Human)
UseRetroviralTagsflagExpressionMammalianMutationaa461-503 deletedAvailable sinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Dynein-2_complex
Plasmid#132536PurposeFull length human (Hs) IFT dynein (dynein-2) complex for Sf9 expression. Contains His-ZZ-TEV-SNAPf-HC, WDR60, WDR34-Strep, LIC3, TCTEX-1, TCTEX1D2, LC8-1, LC8-2, TCTEX-3, Rbl-1, Rbl-2, LC8-like.DepositorInsertsTags8x His, Linker-TEV-linker-TEV, SNAPf, Strep, and …ExpressionInsectMutationCodon optimised for Sf9 expressionAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-MMLV-gag-hMLH1dn
Plasmid#195513PurposeMMLV-Gag fused to hMLH1dn with TSTLLMENSS cleavage site between Gag-NES and hMLH1dn. For production of virus like particles with base-editor RNP cargo.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthMLH1dn (MLH1 Human)
UseVirus like particleTagsFLAG, NES, and Protease cleavate siteExpressionMammalianMutationHuman MLH1 del754-756PromoterCMVAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1GZmbh
Plasmid#44522DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ2
Plasmid#197415PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-2 σ2 fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-2 σ2
TagsGAL4-DNA binding domain fragment, HA tag, and nuc…ExpressionYeastMutationencodes R42G substitution, contains silent substi…PromoterADH1 and MET25Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEA01
Plasmid#170766PurposeUtilisation of pSAM2 excision tool in Amycolatopsis sppDepositorInsertsxis, int
oriT
pac
ExpressionBacterialPromotertrcpAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-TGFBR2-m3_3'UTR
Plasmid#31883DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTGFBR2 mutant 3'UTR (TGFBR2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationThird miR-302b, 372 7-mer seed match mutated from…PromoterSV40Available sinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by