We narrowed to 13,244 results for: BASE
-
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.H1-NP
Plasmid#134367PurposeNanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.DepositorInsertH1-NP (HRH1 Human)
TagsFlag and natural peptide of nanoluciferaseExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-cmyc-optiT1R3 a21-852
Plasmid#113948Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-8his
Plasmid#111846PurposeMammalian expression plasmid for soluble BG505 SOSIP.664; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
Tags8his purification tag and CD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Rims2-GFP KI
Plasmid#131495PurposeEndogenous tagging of RIM2: C-terminal (amino acid position: S1551)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-c-myc-optiT1R3 ECD
Plasmid#113960Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830)
Plasmid#160624PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain VPR (VP64+p65+Rta)DepositorInsertP35S:MS2:VPR:Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVC-DNAJB6b
Plasmid#175065Purposeexpresses mVenus and mCherry tagged DNAJB6b in mammalian cellsDepositorInsertDNAJB6b (DNAJB6 Human)
TagsV5 and mVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-2xTS
Plasmid#109419PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP302-pAAV-CMV-dSaCas9-KRAB-pA
Plasmid#113677PurposeA CMV driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMG81-MBP-t-M.MpeI-N374K-His
Plasmid#197985PurposeExpresses CpG Carboxymethyltransferase (M.MpeI N374K) in bacteria. The gene also encodes an N-terminal (TEV cleavable) MBP tag as well as C-terminal His tag.DepositorInsertMBP-t-M.MpeI-N374K-His
TagsHis and MBPExpressionBacterialMutationM.MpeI-N374KAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:TV:Tnos (GB2048)
Plasmid#160627PurposeTU for the constitutive expression of Ms2 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-MS2:TV-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank2-GFP KI
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-QES.i05.c06
Plasmid#123276PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (BG505) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-xCas9(3.7)-P2A-EGFP (RTW4644)
Plasmid#140004PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with xCas9(3.7)(D10A/A262T/R324L/S409I/E480K/E543D/M694I/E1219V) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) xCas9(3.7) with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; xCas9(3.7)=A262T/R324L/S409I/E480K/…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only