We narrowed to 7,499 results for: addgene/1000
-
Plasmid#160102PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only
-
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7_R505C
Plasmid#160104PurposeExpresses murine Fbxw7 alpha with the R505C loss-of-function mutation in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-QKI-7 [N183/15R-2b]
Plasmid#219485PurposeMammalian Expression Plasmid of anti-QKI-7 (Human) subclass-switched IgG2b R-mAb. Derived from hybridoma N183/15.DepositorInsertAnti-QKI-7 (Homo sapiens) recombinant mouse monoclonal antibody. (Qki Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#1/Cre
Plasmid#173635PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7a (closed)
Plasmid#160101PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#2/Cre
Plasmid#173636PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7_R505C (closed)
Plasmid#160103PurposeExpresses murine Fbxw7 alpha with the R505C loss-of-function mutation in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_KanR_BastaR_Rb7_GFP
Plasmid#186427Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)DepositorInsertsKanR
BastaR
Rb7
eGFP
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJT236 lenti pEF-rTetR(SE-G72P)-3XFLAG-CXXC1 PHD-T2A-mCherry-BSD-WPRE
Plasmid#188764PurposeLentiviral backbone containing CXXC1 PHD as a fusion with rTetR(SE-G72P)-3XFLAGDepositorInsertCXXC1 PHD (CXXC1 Human)
UseLentiviralTagsrTetR(SE-G72P)-3xFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUW-VenusFlag-hCD44
Plasmid#211824PurposeExpress CD44 in mammalian cellsDepositorInsertCD44 (CD44 Human)
UseLentiviralTagsN-Terminal Venus and Flag tagsExpressionMammalianMutationisoform corresponds to UniProt ID P16070-1 with a…Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMB.PRC1.1_RING1B_MBP-PCGF1
Plasmid#252956PurposeExpression of PRC1.1 core (RING1B and PCGF1) in insect cells.DepositorTagsHis-Dual-Strep and MBPExpressionInsectPromoterpolHAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
Anti-Mitofusin-1 [N111/48R]
Plasmid#225378PurposeMammalian Expression Plasmid of anti-Mitofusin-1 (Mouse) IgG2a R-mAb. Derived from hybridoma N111/48.DepositorInsertAnti-Mitofusin-1 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Mfn1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Mitofusin-1 [N111/27R]
Plasmid#225377PurposeMammalian Expression Plasmid of anti-Mitofusin-1 (Mouse) IgG2a R-mAb. Derived from hybridoma N111/27.DepositorInsertAnti-Mitofusin-1 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Mfn1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7(res)
Plasmid#160106PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-SynCAM1 [L45/30R]
Plasmid#177482PurposeMammalian Expression Plasmid of anti-SynCAM1 (Mouse). Derived from hybridoma L45/30.DepositorInsertanti-SynCAM1 (Mus musculus) recombinant mouse monoclonal antibody (Cadm1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-SynCAM1 [L45/30-2b] - Chimeric
Plasmid#227033PurposeMammalian expression plasmid of anti-SynCAM1 cell adhesion molecule (Mouse). Derived from hybridoma L45/30.DepositorInsertAnti-SynCAM1 cell adhesion molecule (Mus musculus) recombinant mouse monoclonal antibody. (Cadm1 Mouse)
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-tws
Plasmid#195068PurposeExpresses FLAG-tagged Drosophila tws proteinDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only