We narrowed to 16,208 results for: grna
-
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA-MS2-U6
Plasmid#171694PurposeTo construct expression vector for tBE-V5-mA3DepositorInsertsgRNA scaffold-MS2-U6
UseCRISPRExpressionMammalianAvailable sinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pM150: pAAV.CMV-Cas13e-VEGFA sgRNA array
Plasmid#203448PurposePlasmid expressing active Cas13e with an array of three VEGFA mRNA targeting gRNAsDepositorInsertsU6-VEGFA sgRNA array
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM156: pAAV.CMV-Cas13e (GenScript CO)-VEGFA sgRNA
Plasmid#203452PurposePlasmid expressing active and codon optimised Cas13e with VEGFA gRNADepositorInsertsU6-VEGFA sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-NmeCas9-TLR-MCV1-sgRNA
Plasmid#117407PurposeNmeCas9 sgRNA targeting TLR2.0DepositorInsertNmeCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-CjeCas9-TLR-MCV1-sgRNA
Plasmid#117408PurposeCjeCas9 sgRNA targeting TLR2.0DepositorInsertCjeCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SauCas9-TLR-MCV1-sgRNA
Plasmid#117409PurposeSauCas9 sgRNA targeting TLR2.0DepositorInsertSauCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14112 tyrosinase-targeting sgRNA
Plasmid#239751Purposeguide for tyrosinaseDepositorInsertguide targeting tyrosinase
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA1
Plasmid#223519Purposeknocking out hGSDME in human cellsDepositorAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pM115: CasRx control presgRNA
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; EGF_gRNA
Plasmid#199333PurposepDEL158; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 EGF sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertszCREST3
Cas9
nrg1 EGF sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJH031_proD_LbCas12a-gRNA-GFP_CAM
Plasmid#183075PurposePlasmid expressing Cas12a guide RNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertLbCas12a guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS2_DF_A4b_attP_fwd
Plasmid#182149PurposeTo insert attP-fwd attachment site at IDS2 in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIDS2-A4b-attP-fwd pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_D1b_attB_rev
Plasmid#182152PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIDS-D1b-attB-rev pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sp-gRNA-IDS_DF_C2c_attB_rev
Plasmid#182151PurposeTo insert attB-rev attachment site at IDS in human cells via twinPEDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIDS-C2c-attBrev pegRNA
ExpressionMammalianPromoterhU6Available sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only