We narrowed to 16,652 results for: grn
-
Plasmid#86355PurposeEncodes gRNA for 3' target of human DMAP1DepositorInsertgRNA against DMAP1 (DMAP1 Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_DMAP1_1
Plasmid#86354PurposeEncodes gRNA for 3' target of human DMAP1DepositorInsertgRNA against DMAP1 (DMAP1 Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_1
Plasmid#106306PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_2
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_2
Plasmid#104047PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_1
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_1
Plasmid#86344PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAT-9222
Plasmid#124222PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-sDepositorInsertself-targeting gRNA between EGFP halves
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_2
Plasmid#86345PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_2
Plasmid#104043PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_1
Plasmid#104042PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-CsALSgR1.1
Plasmid#245875PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALS_gRNA1.1
UseCRISPR; Golden gate entry vector to expressing t…ExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_tnnt2a_cmlc2-nmKate
Plasmid#238309PurposeDrives expression of 3 different gRNAs targeting tnnt2a, and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting tnnt2a
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-FXR1-G266E
Plasmid#225482PurposeExpress epegRNA for FXR1DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only