We narrowed to 13,244 results for: BASE;
-
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-Puro
Plasmid#110848PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLN552 (FuGW-S(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105202PurposeModule 1 - synthetic promoter USF1 drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 extracellular-cysteineless (NT864)
Plasmid#49069PurposeExpresses human NKCC1 mutant lacking extracellular cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC563S,C568S,C577S,C582S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL15 IRES miRFP720-P2A-Blast
Plasmid#248032PurposeConstitutively expresses myc tagged membrane bound IL15, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL15 (IL15 Human)
UseLentiviralTagsMycExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGIPZ EF1a myc tagged mbIL2 IRES miRFP720-P2A-Blast
Plasmid#248031PurposeConstitutively expresses myc tagged membrane bound IL2, miRFP720 and a blasticidin resistance gene in human cellsDepositorInsertmyc-tagged membrane bound IL2 (IL2 Human)
UseLentiviralExpressionMammalianPromoterhuman EF1aAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-A18G-B/c
Plasmid#246715PurposeEntry plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation and a chloramphenicol-ccdB cassette flanked by 2 BsaI sites (MIR390a Mustard Weed)
UseGateway-compatible entry vectorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-BS-AtMIR390a-A18G-B/c
Plasmid#246716PurposeCloning amiRNA sequences in AtMIR390a-A18G precursors for in planta expressionDepositorInsertBasal stem of Arabidopsis MIR390a precursor with A18G mutation & chloramphenicol-ccdB cassette flanked by two BsaI sites (MIR390a Mustard Weed)
UseRNAiExpressionPlantAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-DNMT3A (dCas9-3A-3A)
Plasmid#218776PurposeExpresses dCAS9-DNMT3A-DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3A (dCas9-3A-3A)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-DNMT3L (dCas9-3A-3L)
Plasmid#218777PurposeExpresses dCAS9-DNMT3A-DNMT3L fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3L (dCas9-3A-3L)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-KRAB (dCas9-3A-KRAB)
Plasmid#218781PurposeExpresses dCAS9-DNMT3A-KRAB fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3L (dCas9-3A-3L)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-mutDNMT3A(R882H)(dCas9-mut3A)
Plasmid#218788PurposeExpresses dCAS9- R882H Mutated DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-MutDNMT3A (dCas9-Mut3A (R882H))
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP955
Plasmid#239877PurposeTCTP-SynPro-08 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-08::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP956
Plasmid#239878PurposeTCTP-SynPro-09 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-09::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP957
Plasmid#239879PurposeTCTP-SynPro-10 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-10::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only