We narrowed to 15,176 results for: aga
-
Plasmid#53599Purposelentiviral expression of constitutively active PRAS40 and EGFPDepositorInsertPRAS40 (AKT1S1 Human)
UseLentiviralTagsIRES-EGFP and mycExpressionMammalianMutationconstitutively active (myristoylated version)PromoterCMVAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EMCV_3C
Plasmid#201941PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLT 652
Plasmid#59997PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans dhc-3/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HRV-B14_3C
Plasmid#203466PurposeExpresses HRV-B14 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-EIF2AK2-ts1
Plasmid#174247PurposeEIF2AK2 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Raichu-OsRac1 CA
Plasmid#133264PurposeConstitutively-active (CA) mutant of OsRac1; Acts as a positive control for small GTPases activation assays.DepositorInsertOsRac1(G19V) (LOC4325879 Oryza sativa)
TagsCFP-lipid and Venus-CRIBExpressionPlantMutationOsRac1 G19VPromoterUbiAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Raichu-OsRac1 DN
Plasmid#133263PurposeDominant-negative (DN) mutant of OsRac1; Acts as a negative control for small GTPases activation assaysDepositorInsertOsRac1(T24N) (LOC4325879 Oryza sativa)
TagsCFP-lipid and Venus-CRIBExpressionPlantMutationOsRac1 T24NPromoterUbiAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV/myc/ER-αT2ib
Plasmid#110769PurposeExpresses ER intrabody against mouse and human TLR2DepositorInsertintrabody against mouse and human TLR2
TagsER retention signal (SEKDEL), ER signal peptide, …ExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YD EGFP
Plasmid#187264PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsEGFPMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-HA-FLAG-AU1
Plasmid#162098PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-ProtC
Plasmid#162099PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-ProtC
UseLentiviralTagsVSVg-StrepTagII-ProtCMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-Halo-hMRE11(H129N)
Plasmid#208394PurposeTo generate stable cell line expressing Halo-human MRE11(H129N) by Retroviral infection.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcFLAG-CSK-delta SH3 (73 to450 amino acids)
Plasmid#74504PurposeOverexpression of CSK delta SH3 in mammalian cellsDepositorInsertCSK (CSK Human)
TagsFLAGExpressionMammalianMutationdel-SH3 (73 to450 amino acids)PromoterCMVAvailable SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-Zfp423-deltaSBD
Plasmid#35971DepositorInsertZinc Finger Protein 423 (Zfp423 Mouse)
UseRetroviralTagsFlagExpressionMammalianMutationlacks zinc fingers 14-19 (aa 640 -838) (delta SMA…Available SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_SV40
Plasmid#99311PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV1-B
Plasmid#74974PurposeshETV1 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-K1347A
Plasmid#25052DepositorAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-CEBPa-WT
Plasmid#215601PurposeFor overexpression of Gal4-DBD CEBPa WTDepositorInsertCEBPa (CEBPA Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP WT
Plasmid#197567PurposeExpression of sfGFP WT with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6) (4x copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only