We narrowed to 15,447 results for: grn
-
Plasmid#19746DepositorInsertoligo targeting p53 and PTEN (Pten Mouse)
UseCre/Lox, RNAi, and RetroviralExpressionMammalianAvailable sinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEE082 FoMV
Plasmid#234811PurposeTo clone guide RNA (gRNA) along with its scaffold in to the Foxtail Mosaic Virus Vector (T-DNA)DepositorTypeEmpty backboneExpressionPlantAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBA620
Plasmid#186240PurposeLbuCas13a Negative Control (RFP targeting)DepositorInsertpTet-LbuCas13a + crRNA negative control
ExpressionBacterialAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
lis-1::L4440
Plasmid#11336DepositorAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJP_Bla01
Plasmid#230982PurposeModified version of the pBLADE_ONLY_C (#168050). It expresses VVD-AraC, but the f1 ori was deleted and the chloramphenicol resistance gene was replaced by gentamicin resistance.DepositorInsertGentamicin resistance gene
ExpressionBacterialAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJP_Ctrl04
Plasmid#230983PurposepBAD promoter controls the expression of sfGFP. In the presence of VVD-AraC, blue light and L-arabinose can be used to activate sfGFP expression.DepositorInsertpBAD promoter, no araC
ExpressionBacterialAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJP_1node
Plasmid#230984PurposepBAD promoter controls the expression of sfGFP. In the presence of VVD-AraC, blue light and L-arabinose can be used to activate mCitrine expression.DepositorInsertmCitrine
ExpressionBacterialAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-plus
Plasmid#126767PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteSpCas9-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgTSC2
Plasmid#128098PurposeCRISPR gRNA against human TSC2 with Cas9 from S. pyogenes and 2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA against human TSC2 (TSC2 Human)
UseCRISPRExpressionMammalianPromoterhU6Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting Suz12 (Suz12 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pORANGE Rims2-GFP KI
Plasmid#131495PurposeEndogenous tagging of RIM2: C-terminal (amino acid position: S1551)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpG-PPE
Plasmid#170130PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertnCas9-SpG(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T1…Promotermaize Ubiquitin-1Available sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-sh-mFAK C
Plasmid#37015DepositorAvailable sinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2301
Plasmid#91067PurposeModule B, Promoter: 35S, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with tRNA spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with tRNA spacers
UseCRISPRPromoter35SAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ftz-M3
Plasmid#11245DepositorInsertFtz-M3
Tags3 MS2 hairpinsExpressionBacterialAvailable sinceJan. 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJPC596 FoMV-AmCyan
Plasmid#234812PurposeTo express flourescent protein AmCyan from the Foxtail Mosaic Virus Vector (T-DNA)DepositorInsertAmCyan
ExpressionPlantAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only