We narrowed to 23,589 results for: ica;
-
Plasmid#27228DepositorInsertEGFP
UseLentiviralTagsEGFPExpressionMammalianAvailable SinceMarch 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-mKate
Plasmid#208793PurposeFor AAV production to express C2m2-mKate in astrocytesDepositorInsertC2m2-mKate (Mfge8 Mouse)
UseAAVTagsmKateExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-Rheb(S16H)
Plasmid#194204PurposeCre/LoxP-dependent expression of a constitutively active form of Rheb (S16H). Expression of Cre excises a STOP codon before Rheb(S16H), facilitating expression of a constitutively active form of Rheb.DepositorInsertRas Homolog Enriched Protein in Brain (S16H) (RHEB Human)
UseCre/LoxExpressionMammalianMutationS16HAvailable SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-mCherry-hCdt1(1-100)ΔCy
Plasmid#193759PurposeExpresses N-CRL4Cdt2 reporter(mCherry-hCdt1(1-100)ΔCy)DepositorInsertmCherry-hCdt1(1-100)ΔCy (CDT1 Human)
UseLentiviralMutationhuman Cdt1 amino acids 1-100 w/ ΔCy mutation (aa6…PromoterEF1aAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IPU-FLAG-NEK9T210A
Plasmid#168270PurposeExpresses kinase-dead NEK9 mutant in mammalian cellsDepositorAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus2-Y705F-STAT3
Plasmid#123173PurposeExpresses Y705F STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationY705F substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-S727A-STAT3
Plasmid#123175PurposeExpresses S727A STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationS727A substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422gp140-TM
Plasmid#123251PurposeMammalian expression plasmid for soluble gp140 from the DU422 HIV-1 isolate with a transmembrane tetherDepositorInsertHIV-1 (DU422) Env
TagsCD5 leader peptide and Linker (with 6his tag) and…ExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTn7·X-nia
Plasmid#122592PurposePlasmid for genomic integraction of xylS-Pm->nia into the Tn7 insertion siteDepositorInsertxylS/Pm->Nia
UseSynthetic Biology; Tn7 genomic integrationExpressionBacterialPromoterPmAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Jaws-KGC-GFP-ER2
Plasmid#99233PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the CAG promoter. Using bGH pA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTO_Snf7_LAP
Plasmid#101851PurposeTet-inducible expression of Snf7 from S. cerevisiae with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertSNF7 (SNF7 Budding Yeast)
UseGateway cloning, flp-frt recombination, tet-induc…TagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianPromoterCMVAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
nes374tk/lacZ
Plasmid#47615Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation374 bp from 2nd intron (comprising bp 1153 to 152…PromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
p068 pCS mTRPS1 (M)
Plasmid#11040DepositorInsertTRPS1 mut (Trps1 Mouse)
UseXenopus, mammalian, avian, and zebrafishMutationTwo Cys residues at positions 917 and 920 in the …Available SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
p300dAIL KAT LIC 1M
Plasmid#233588PurposeBacterial expression of p300 KAT enzyme with truncated autoinhibitory loopDepositorInsertp300dAIL KAT (EP300 Human)
Tags6xHis MBPExpressionBacterialMutationdeleted amino acids 1523-1554PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFOXA2-T2A-mTagBFP2-PGK-Neo
Plasmid#223191PurposeBFP reporter plasmid targeting the human FOXA2 geneDepositorInsertFOXA2-T2A-mTagBFP2-PGK-Neo-FOXA2 (FOXA2 Human)
UseCre/Lox; Human targetingAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-flex-iGluSnFR4f-PDGFR-WPRE
Plasmid#234448PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1314-AAV-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223159PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-UbC-FKRP-EF1a-BSD
Plasmid#205150PurposeExpress UbC-driven FKRP and EF-1a driven BSDDepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-SNAP
Plasmid#208791PurposeFor AAV production to express C2m2-SNAP in astrocytesDepositorInsertC2m2-SNAP (Mfge8 Mouse)
UseAAVTagsSNAP-tagExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only