We narrowed to 10,272 results for: tre promoter
-
Plasmid#214262PurposePaFtsH2-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInserttLST accessory element PaFtsH2 protease of Pseudomonas aeruginosa SG17M
Tags6x His-tag and 6xHis-tagExpressionBacterialPromoterT7 promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
10X PRE TK luc
Plasmid#206162PurposeLuciferase reporter construct containing 10 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert10X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
8X PRE TK luc
Plasmid#206161PurposeLuciferase reporter construct containing 8 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert8X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW pHluorin-SYT9 IRES mRuby3
Plasmid#195698PurposeLentiviral plasmid encoding SYT9 with an N-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Syt9 IRES mRuby3
Plasmid#195700PurposeLentiviral plasmid encoding full-length mouse SYT9 followed by an internal ribosomal entry site followed by mRuby under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP
Plasmid#202053PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHELDepositorInsertAtWUS E. Coli Codon Optimized (WUS Mustard Weed)
Tags6xHis and GFP11ExpressionBacterialPromoterT7 PromoterAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-nsp7
Plasmid#201025PurposeExpresses SARS-CoV-2 nsp7 under control of a tetracycline-inducible promoter in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
ExpressionMammalianPromoterCMV-tet-ONAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABR mCherry-Bcd-LEXY
Plasmid#182596PurposeDrosophila integration plasmid expressing mCherry-Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3R2
Plasmid#179163PurposeExpression vector of human protein phosphatase 3, regulatory subunit B, beta isoform (PPP3R2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (PPP3R2 Human)
ExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mPpp3r2
Plasmid#179161PurposeExpression vector of mouse protein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2 Mouse)
ExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hSPATA33-8xHIS-1D4
Plasmid#179133PurposeExpression vector of human spermatogenesis associated 33 (SPATA33) tagged with 8XHIS and 1D4 at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_RalA(G23V,full)-P2A-Hygro_Barcode
Plasmid#170249PurposeBarcoded lentiviral vector to express RalA(G23V, full) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFL GST-UBXN2A
Plasmid#169016PurposeExpresses GST-UBXN2A (human) in insect cellsDepositorAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#797
Plasmid#110916PurposeExpresses the active zone - enriched protein Sentryn-GFP in a subset of cholinergic ventral nerve cord motor neuronsDepositorInsertsunc-129 promoter
STRN-1 (Sentryn)-GFP
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
TagsGFP (contains 3 artificial introns)ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Phhf2-PYC-Tadh1
Plasmid#127737PurposeYeast pathway position 5. PYC transcription unit with the HHF2 promoter and ADH1 terminator.DepositorInsertpyruvate carboxylase (PYC1 Budding Yeast, Synthetic)
UseSynthetic BiologyExpressionYeastPromoterPhhf2Available SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
N229A Lo-MetQ
Plasmid#118268PurposeN229A Mutation in Methionine Binding Protein (MetQ) used to solve crystal structureDepositorInsertMetQ (N229A) (metQ E. coli)
Tags10x His Tag and Enterokinase Cleavage SiteExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala)PromoterT7 PromoterAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Tra].1046D
Plasmid#112693Purposeexpress two gRNA targeting bTub & Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-N-SH2
Plasmid#111274Purposeexpress murine Syk (N)SH2 domain (Ser 8 to Gly 117), with an N-terminal (His)6 tag and TEV cleavage site, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (N)SH2 domain (Ser 8 to Gly 117), with an N-terminal (His)6 tag and TEV cleavage site (Syk Mouse)
TagsHHHHHHENLYFQGExpressionBacterialPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN018
Plasmid#91664PurposeExpress sgRNA targeting human SCN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only