We narrowed to 10,560 results for: fus
-
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Affibody HER2:243.BirA*-pET301/NT-DEST
Plasmid#174692PurposePlasmid encoding for the bacterial expression of a bispecific coding for the anti-HER2 affibody ZHER2:342 fused to the mutated form of BirA enzyme, BirA*DepositorInsertAnti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
TagsHIS tagExpressionBacterialMutationR118G mutation in BirAPromoterT7 promoterAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2CP-VPg(FCV)
Plasmid#167314PurposeTemplate pDNA to prepare CaVT mRNADepositorInsertCaVT
UseSynthetic BiologyTagsDYK-tagExpressionMammalianPromoterCMVAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4134904
Plasmid#151930PurposeMammalian expression plasmid for SARS-CoV-2 spike prefusion-stabilizedDepositorInsertSARS-CoV-2 spike prefusion-stabilized (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationd1-15 d1209-1273 R682A R685G K986P V987PPromoterCMVAvailable SinceMay 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1_GP1Fc Cl13
Plasmid#138599PurposeExpresses GP1 of LCMV Cl13 fused with human IgG (Fc fusion)DepositorInsertLCMV GP1-Fc
TagsFc fusion proteinExpressionMammalianPromoterCMVAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFS_0414_pET30_MCS-BBaJ23100-LuxR-B0015term-pLux rR-Fluc-rrnBterm-pCat-tetR-Term-ptetA-Rluc-rrnBterm_FsRT-Cas1-Cas2_ARRAY2_FaqI
Plasmid#117005PurposeExpresses FsRT-Cas1-Cas2 under pT7lac, Fluc under pLuxR and Rluc under ptetA promoter, encodes FsCRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-2xTS
Plasmid#109419PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-nAChr-Alpha6-mCherry
Plasmid#50480Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChr-alpha6 (Chrna6 Mouse)
TagsmCherry fusion in M3-M4 loop (after residue A405)ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFB-Flag-MyoD-E12
Plasmid#25990DepositorAvailable SinceSept. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCOA-Leu-FvPPT1-fsr1
Plasmid#179868PurposeConstitutive expression vector for Saccharomyces cerevisiae comprising the polyketide synthase fsr1 from Fusarium vanettenii and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1DepositorInsertsPPT1
fsr1
ExpressionYeastMutationCodon optimized for expression in Saccharomyces c…PromoterYarrowia lipolytica EXP1 and Yarrowia lipolytica …Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdICAM1-ST3-His
Plasmid#210666PurposeExpression of the extracellular domain of human ICAM1 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human ICAM-1 fused to Spytag003 and Histag (ICAM1 Synthetic, Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
BC-Sig-GPRC
Plasmid#44201DepositorInserthuman GPR56 C-terminal fragment with signal peptide (ADGRG1 Human)
UseRetroviralTagsnoneExpressionMammalianMutationThe C-terminal fragment of GPR56, starting at am…PromoterLTRAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUB6-HuMGF
Plasmid#190782PurposeExpresses membrane-bound form of human SCF in mammalian cellsDepositorAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLC-HA active Nedd8-P2A-Hygro
Plasmid#124307PurposeLentiviral vector for expression of HA tagged active or C-terminal cleaved Nedd8-P2A-Hygro casette from a CMV promoterDepositorInsertNedd8 (NEDD8 Human)
UseLentiviralTagsHAExpressionMammalianMutationFive C-terminal amino acids missing compared to w…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-EGFP-Cx43ML-N1
Plasmid#49860PurposeEncodes human connexin 43 with all internal methionines mutated to leucine and a C_terminal EGFP fusion tagDepositorInsertConnexin 43 (GJA1 Human)
TagsEGFPExpressionMammalianMutationAll internal Methionines mutated to Leucine. No s…PromoterCMVAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
Plasmid#189630PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.DepositorInsertsGaussia luciferase fused to Fc
IRES-EGFP
UseAAV, Cre/Lox, and LuciferaseTagsGluc and IgG1 FcExpressionMammalianPromoterIRES and hSynAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
JG676: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X2)
Plasmid#104569PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to two DmrA domainsDepositorInsertdLbCpf1(D832A)-DmrA(x2)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only