We narrowed to 133 results for: mClover3
-
Plasmid#196110Purposemammalian/zebrafish expression of zemiRFP2-EF1-2xCMV-EF1-mClover3DepositorInsertzemiRFP2-EF1-2xCMV-EF1-mClover3
ExpressionMammalianAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-mClover3-anti-mouse-IgG(kappa)-nanobody
Plasmid#138128PurposeExpresses GST-tagged mClover3-anti-mouse-IgG(kappa)-nanobody in E. coli cells.DepositorInsertmClover3-anti-mouse-IgG(kappa)-nanobody
TagsGSTExpressionBacterialAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-mClover3-TEV
Plasmid#105778PurposeExpression of your protein of interest in fusion with green fluorescent protein at the N-terminus (cleavable by TEV). mClover3 is a brighter derivative of mEGFP (PMID: 26879144).DepositorTypeEmpty backboneUseFlp-in competentTagsmClover3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mClover3
Plasmid#105795PurposeExpression of your protein of interest in fusion with green fluorescent protein at the C-terminus (cleavable by TEV). mClover3 is a brighter derivative of mEGFP (PMID: 26879144).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-mClover3-Puromycin
Plasmid#167205PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with mClover3 and selection with PuromycinDepositorTypeEmpty backboneUseCRISPRTagsmClover3ExpressionMammalianAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-ORF1-3C-mRuby3_ORF2-TEV-mClover3
Plasmid#105802PurposeConcomitant expression of two proteins. One protein expressed with mRuby3, cleavable by 3C; second protein expressed with mClover3, cleavable by TEV protease; tags positions: C-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-mRuby3; ORF2: TEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKanCMV-CX4.3-7aa-mClover3
Plasmid#74260PurposeMammalian expression of C-terminal fusion of mClover3 to CX43DepositorInsertConnexin 43
TagsmClover3ExpressionMammalianPromoterCAG and CMVAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
C122-E53: mClover3
Plasmid#162898PurposeStandard Gateway entry clone encoding mClover fluorescent proteinDepositorInsertmonomeric Clover3 fluorescent protein
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM112C
Plasmid#250587PurposeH2Apr-Lifeact-mClover3-H2AterDepositorInsertH2Bpr-P2A-T2A-HygR-Synther8:H2Apr-Lifeact-mClover3-H2Ater
UseAgrobacterium binary plasmidTagsmClover3Available SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEM110
Plasmid#250586PurposeH2Apr-MRLC-mClover3-FLAG-MRLCterDepositorInsertH2Bpr-P2A-T2A-HygR-Synther8:H2Apr-SpunMLRC-mClover3-SpunMLRCter
UseAgrobacterium binary plasmidTagsmClover3Available SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSIN-TRE-EB3N-VVDfast-mCl3-iLID
Plasmid#190169PurposeDoxycycline-inducible lentivirus vector to express EB3N-VVDfast-mCl3-iLID, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60.DepositorInsertEB3N-VVDfast-mClover3-iLID (MAPRE3 Human, Synthetic)
UseLentiviralTags-VVDfast-mClover3-iLIDMutation1-189 aa from EB3PromoterTREAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEM102
Plasmid#250585PurposeAlphaTUBpr-mClover3-BdenAlphaTUB-BdTUBterDepositorInsertSpunaTubpr-mClover3-Bden-aTub-BdenaTubter:H2Bpr-P2A-T2A-HygR-Synther8
UseAgrobacterium binary plasmidTagsmClover3Available SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-RCC
Plasmid#190635PurposeMammalian expression of genetically encoded calcium indicator RCCDepositorInsertRCC
ExpressionMammalianAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216481PurposeExpresses FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover to initiate immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLox-LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216482PurposeExpresses a lox-p flanked FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover for initiating and removing immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe4-RfA-mClover3-stop
Plasmid#186389PurposeDestination vector for the expression of a fluorescent fusion of a protein of interest with C-ter mClover3 into embryos, by mRNA microinjectionDepositorTypeEmpty backboneUseGateway CloningAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe4-Kozak-mClover3-RfA
Plasmid#186379PurposeDestination vector for the expression of a fluorescent fusion of N-ter mClover3 and a protein of interest into embryos, by mRNA microinjectionDepositorTypeEmpty backboneUseGateway CloningAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKanCMV-CX4.3-7aa-mClover3
Plasmid#74260PurposeMammalian expression of C-terminal fusion of mClover3 to CX43DepositorInsertConnexin 43
TagsmClover3ExpressionMammalianPromoterCAG and CMVAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV mClover3-Galectin-3
Plasmid#215376PurposeExpression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag.DepositorInsertLGALS3 (LGALS3 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only