We narrowed to 19,820 results for: INO
-
Plasmid#242688PurposePlasmid for expression of ACTA2-L180L cDNA from a lentiviral cassetteDepositorInsertpLenti-ACTA2-L180L_cDNA
UseLentiviralExpressionMammalianMutationACTA2-L180LPromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pLenti-ACTA2-M178V (LLH709)
Plasmid#242684PurposePlasmid for expression of ACTA2-M178V cDNA from a lentiviral cassetteDepositorInsertpLenti-ACTA2-M178V_cDNA
UseLentiviralExpressionMammalianMutationACTA2-M178VPromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_GCaMP6f (AAV1)
Viral Prep#213917-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_GCaMP6f (#213917). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_GCaMP6f (AAV1)
Viral Prep#213943-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe3_GCaMP6f (#213943). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the PV+ basket cell-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_GCaMP6f (AAV1)
Viral Prep#213947-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe4_GCaMP6f (#213947). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the SST interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_GCaMP6f (AAV1)
Viral Prep#213939-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe4_GCaMP6f (#213939). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the chandelier cell-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_GCaMP6f (AAV1)
Viral Prep#213859-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiVIPe4_GCaMP6f (#213859). In addition to the viral particles, you will also receive purified pAAV_BiVIPe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the VIP interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_GCaMP6f (AAV1)
Viral Prep#213833-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiCHATe27_GCaMP6f (#213833). In addition to the viral particles, you will also receive purified pAAV_BiCHATe27_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the cholinergic neuron-targeting enhancer E27. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_jGCaMP8m (AAV1)
Viral Prep#213918-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_jGCaMP8m (#213918). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_jGCaMP8m plasmid DNA. Expression of jGCaMP8m under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only