We narrowed to 9,089 results for: sgRNA
-
Plasmid#218219PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA-IM83
Plasmid#251967PurposesgRNA with IM83 aptamer for yeast mtDNA editingDepositorInsertsgRNA-IM83
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
ptetgRNA-FRT
Plasmid#243872PurposesgRNA expression vector under tetR transcriptional control.DepositorInsertsgRNA_FRT
ExpressionBacterialAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B1_M13ps
Plasmid#231422PurposeM13 phagemid that expresses sgRNA-B1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ615.)DepositorInsertsgRNA-B1
UseSynthetic BiologyAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-2_M13ps
Plasmid#231412PurposeM13 phagemid that expresses sgRNA-2 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ171.)DepositorInsertsgRNA-2
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A1_M13ps
Plasmid#231414PurposeM13 phagemid that expresses sgRNA-A1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ164.)DepositorInsertsgRNA-A1
Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-1_M13ps
Plasmid#231409PurposeM13 phagemid that expresses sgRNA-1 from a strong constitutive promoter.DepositorInsertsgRNA-1
UseSynthetic BiologyAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS1sg
Plasmid#154341PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS1 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS2sg
Plasmid#154342PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS2 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CANTsg
Plasmid#154343PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCANT sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAPsg
Plasmid#154344PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAP sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2832
Plasmid#160672PurposeMobile CRISPRi sfGFP 'test', gmc6 sgRNADepositorInsertgmc6 (gfp) sgRNA
ExpressionBacterialAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2820
Plasmid#160669PurposeMobile CRISPRi sfGFP 'test', empty sgRNADepositorInsertempty sgRNA (BsaI)
ExpressionBacterialAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pS448∙CsR
Plasmid#122096PurposeCRISPR/Cas9 counterselection in Gram-negative bacteriaDepositorInsertsCas9
sgRNA
UseSynthetic BiologyExpressionBacterialPromoterPem7 and PmAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJ1-g1g2-K2
Plasmid#218217PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAs, MoClo compatibleDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_RAD21_1
Plasmid#64057PurposeExpresses gRNA against human RAD21 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNA-Y
Plasmid#238993PurposeNode A carrying sgRNA-1 that can be used for the assembly of pEND-Y11DepositorInsertsgRNA-1
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only