We narrowed to 22,178 results for: HAL
-
Plasmid#185046PurposeJ23108(spel), pHP14 stability hairpin, strong RBS, L31p coding region with amino acids 2-8 deleted, trrnBDepositorInsertL31p
ExpressionBacterialMutationAmino acids 2-8 deleted of L31p coding regionAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR111
Plasmid#185047PurposeJ23108(spel), pHP14 stability hairpin, strong RBS, L31p coding region with last 8 amino acids deleted, trrnBDepositorInsertL31p
ExpressionBacterialMutationLast 8 amino acids deleted of L31p coding regionAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR051
Plasmid#185029Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-51 and 80-84 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 47-51 & 80-84 mutated rpmE 5'…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR052
Plasmid#185030Purpose400 nt l31 promoter region, l31 5'UTR with nt. 56-61 and 68-73 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 56-61 and 68-73 mutated in rpmE 5…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR064
Plasmid#185031Purpose400 nt l31 promoter region, scrambled 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides of rpmE 5'UTR scrambled, Only fi…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR102
Plasmid#185033Purpose400 nt l31 promoter region, l31 5'UTR U54C mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationU54C mutation of rpmE 5'UTR, Only first 90 n…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR106
Plasmid#185036Purpose400 nt l31 promoter region, l31 5'UTR G79U mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationG79U mutation of rpmE 5'UTR, Only first 90 n…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR116
Plasmid#185040Purpose400 nt l31 promoter region, l31 5'UTR U58C and U70C, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationU58C and U70C of rpmE of 5'UTR, Only first 9…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR017-L31-sfGFP
Plasmid#185024Purpose400 nt l31 promoter region, l31 5'UTR, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationOnly first 90 nt of rpmE coding presentAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR039
Plasmid#185025Purpose400 nt l31 promoter region, l31 5'UTR with nt. 1-31 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 1-31 deleted from rpmE 5'UTR, On…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR040
Plasmid#185026Purpose400 nt l31 promoter region, l31 5'UTR with nt. 35-46 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 35-46 deleted from rpmE 5'UTR, O…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR041
Plasmid#185027Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-54 & 76-86 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationNucleotides 47-54 & 76-86 deleted from rpmE …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-a2-GEMS(PLCG)
Plasmid#209114PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-a2-GEMS (PLCG)DepositorInsertA-a2-GEMS(PLCG)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 N352A HA
Plasmid#208365PurposeExtracellular HA-tagged Fzd6 N352A (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6 S354I HA
Plasmid#208364PurposeExtracellular HA-tagged Fzd6 S354I (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR 2.1-TOPO Fzd6HA
Plasmid#208363PurposeExtracellular HA-tagged Fzd6 (mouse)DepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only