We narrowed to 25,814 results for: Nov
-
Plasmid#120427PurposeBarcoded lentiviral vector to express ASCL1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLPC-MYC-hTRF1
Plasmid#64164PurposeRetroviral vector expressing human TRF1 with N-terminal MYC tagDepositorAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR mitfa:KIT K642E
Plasmid#118849PurposeExpresses human KIT K642E mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJH3717
Plasmid#191477PurposePacr-2s-Arch::wCherry unc-54 3' UTR C.elegans A/B MN expression of Arch RFPDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 R211L mutant
Plasmid#161991PurposeExpresses two mutated tandem repeats of Tapp1 PH domain (phosphoinositide binding-deficient mutant of TAPP1, R211L, can't bind PI(3,4)P2). Fused to eGFPDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-CMV-TetO2_3C-Avi-His6_IRES-HA-BirA-ER
Plasmid#113898PurposeMammalian (inducible) protein expression, in vivo biotinylation, bicistronic expression of HA-tagged ER-resident E. coli biotin ligaseDepositorTypeEmpty backboneUseLentiviralTags3C-Avi-His6PromoterCMV-MIE-TetO2Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMK322 (TOP2A-mAC (Hygro))
Plasmid#140653PurposeTOP2A tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-tagRFP-KDEL
Plasmid#114177PurposeGateway entry clone containing tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseGateway entry cloneTagsKDEL retention signal and signal peptideAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_eCB2.0
Plasmid#164606PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in Cre positive neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-ET-F656W
Plasmid#72546Purposeexpresses FLAG tagged human BRD4 ET domain (608-699 aa) with F656W mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-ET-I654Q
Plasmid#72545Purposeexpresses FLAG tagged human BRD4 ET domain (608-699 aa) with I654Q mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-ET-L630W
Plasmid#72543Purposeexpresses FLAG tagged human BRD4 ET domain (608-699 aa) with L630W mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
GIV-WT - FLAG
Plasmid#65947PurposeExpression GIV/Girdin in Mammalian cellDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a_FLI1_P2A_Hygro_Barcode
Plasmid#120437PurposeBarcoded lentiviral vector to express FLI1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Flag-cMyc T58A
Plasmid#20076DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only