21,159 results
-
Plasmid#228467PurposeExpresses MMLVgag(C507V)–ABE8e for producing v5 ABE-eVLPsDepositorInsertMMLVgag(C507V)–ABE8e
TagsFLAGExpressionMammalianMutationMMLVgag(C507V)PromoterCMVAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K63
Plasmid#17606PurposeMammalian expression of HA tagged ubiquitin with K63 only, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK63 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7s-WPRE (AAV1)
Viral Prep#104487-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7s-WPRE (#104487). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven GCaMP7s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pV238-vPE
Plasmid#225258PurposeMammalian expression of vPEDepositorInsertvPE
UseCRISPRExpressionMammalianMutationR221K K848A H982A N1317RPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltra
Plasmid#24129Purpose3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interestDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K48
Plasmid#17605PurposeMammalian expression of HA tagged ubiquitin with only K48, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK48 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-PR rep/cap
Plasmid#197565Purposeencodes AAV-PR capsid that transduces pericytes and smooth muscle cells in mice after systemic deliveryDepositorInsertsAAV Rep genes
AAV9 VP1 Cap gene with PR insert
UseAAVMutationcontains 7mer insert PRPPSTH between amino acids …Available SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV9)
Viral Prep#20298-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only