We narrowed to 12,430 results for: cel.2
-
Plasmid#205034PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-L2
TagsGRRGKKSRKGRRGKKSRK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(0)-H2
Plasmid#205037PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-H2
TagsKRRRKKKRRRKK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsTNRC6C_1-1207_M
Plasmid#146944PurposeMammalian Expression of HsTNRC6C_1-1207DepositorInsertHsTNRC6C_1-1207 (TNRC6C Human)
ExpressionMammalianMutation2 silent mutations compared to the sequence of Hs…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVY-12 CAT-tag3
Plasmid#194627Purposeantibiotic resistance enzyme with cationic peptide tag to promote biomolecular condensate formation in E. coliDepositorInsertCAT-(GGSKKRKKR)3
TagsGGSKKRKKRGGSKKRKKRGGSKKRKKR and MGHHHHHGGAExpressionBacterialPromoterT7Available SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sox3gRNA-T1
Plasmid#127777PurposeChicken sox3 gRNA target site 1, cloned into the pU6 sgRNA (backbone #92359)DepositorInsertsox3gRNAT1
UseCRISPRAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS_KS_attB2_SA(1)_T2AGeneSwitch
Plasmid#125215PurposeArtificial phase 1 exon to include a spliced T2A-GeneSwitch effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGeneSwitch
UseOtherTagsT2AAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pBW769_pCAG-PV3-FRT-loxP-iRFP720-BGHpA
Plasmid#87576PurposePV3 for 2-input, 4-output decoder circuitDepositorInsertiRFP720
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW806_pCAG-PV3-FRT-loxP-GFP-BGHpA
Plasmid#87582PurposePV3 for 3-input, 2-output Full AdderDepositorInsertEGFP
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW807_pCAG-PV4-loxP-mCherry-BGHpA
Plasmid#87583PurposePV4 for 3-input, 2-output Full AdderDepositorInsertmCherry
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW770_pCAG-PV4-loxP-mRuby2-BGHpA
Plasmid#87577PurposePV4 for 2-input, 4-output decoder circuitDepositorInsertmRuby2
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Dmel Or94b
Plasmid#59691PurposeProbe for Drosophila melanogaster Or94b expressionDepositorInsertOr94b (Or94b Fly)
ExpressionBacterialAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA5/FRT/TO SSA1
Plasmid#19462DepositorInsertSSA1 (SSA1 Budding Yeast)
ExpressionMammalianAvailable SinceOct. 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSP64T3 BMP2 pro dnmVg1 (DM#182)
Plasmid#15074DepositorInsertBMP2-Vg1 dom neg
UseSp6 expression for use in xenopusMutationdominant negative version of BMP2-Vg1 chimera. Th…Available SinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-blast
Plasmid#208034PurposeEnables expression of 2 ORFs (with or without tags) and selection with blasticidin in insect cells. Includes Flag-mCherry-T2A-GFP-T2A-blast with Actin5C promoter.DepositorTypeEmpty backboneExpressionInsectAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-CDS
Plasmid#136037PurposeUPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-puro
Plasmid#208032PurposeEnables expression of 2 ORFs (with or without tags) and selection with puromycin in insect cells. Includes Flag-mCherry-T2A-GFP-T2A-puro with Actin5C promoter.DepositorTypeEmpty backboneExpressionInsectAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-TREX1
Plasmid#164245Purposeretroviral plasmid for GFP-TREX1DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only